1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Study on anti-atherosclerosis mechanism of blood components of Guanxin Qiwei tablets based on HPLC-Q-Exactive-MS/MS and network pharmacology
Yuan-hong LIAO ; Jing-kun LU ; Yan NIU ; Jun LI ; Ren BU ; Peng-peng ZHANG ; Yue KANG ; Yue-wu WANG
Acta Pharmaceutica Sinica 2025;60(2):449-458
The analysis presented here is based on the blood components of Guanxin Qiwei tablets, the key anti-atherosclerosis pathway of Guanxin Qiwei tablets was screened by network pharmacology, and the anti-atherosclerosis mechanism of Guanxin Qiwei tablets was clarified and verified by cell experiments. HPLC-Q-Exactive-MS/MS technique was used to analyze the components of Guanxin Qiwei tablets into blood, to determine the precise mass charge ratio of the compounds, and to conduct a comprehensive analysis of the components by using secondary mass spectrometry fragments and literature comparison. Finally, a total of 42 components of Guanxin Qiwei tablets into blood were identified. To better understand the interactions, we employed the Swiss Target Prediction database to predict the associated targets. Atherosclerosis (AS) disease targets were searched in disease databases Genecard, OMIM and Disgent, and 181 intersection targets of disease targets and component targets were obtained by Venny 2.1.0 software. Protein interactions were analyzed by String database. The 32 core targets were selected by Cytscape software. Gene Ontology (GO) enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis were performed in DAVID database. It was found that the anti-atherosclerosis pathways of Guanxin Qiwei tablets mainly include lipid metabolism and atherosclerosis and AGE-RAGE signaling pathway in diabetic complications and other signal pathways. The core targets and the core compounds were interlinked, and it was found that cryptotanshinone and tanshinone ⅡA in Guanxin Qiwei tablets were well bound to TNF, PPAR
3.Ameliorative effects of Lycii Fructus-Chrysanthemi Flos at different ratios on retinal damage in mice.
Bing LI ; Sheng GUO ; Yue ZHU ; Xue-Sen WANG ; Dan-Dan WEI ; Hong-Jie KANG ; Wen-Hua ZHANG ; Jin-Ao DUAN
China Journal of Chinese Materia Medica 2025;50(3):732-740
This study aimed to compare the ameliorative effects of Lycii Fructus and Chrysanthemi Flos at different ratios on retinal damage in mice and to elucidate the underlying mechanisms. A retinal injury model was established by intraperitoneal injection of sodium iodate(NaIO_3) solution. The mice were divided into the following groups: blank group, model group, positive drug(AREDS 2) group, low-and high-dose groups of Lycii Fructus and Chrysanthemi Flos at 1∶1, low-and high-dose groups at 3∶1, and low-and high-dose groups at 1∶3. Administration was carried out 15 days after modeling. The visual acuity of the mice was assessed using the black-and-white box test. The fundus was observed using an optical coherence tomography device, and retinal thickness was measured. HE staining was used to observe the morphology and pathological changes of the retina. The levels of oxidative factors in serum and ocular tissues were measured using assay kits. The levels of inflammatory factors in serum and ocular tissues were detected by enzyme-linked immunosorbent assay(ELISA), and the expression of Nrf2, HO-1, and NF-κB proteins in ocular tissues was analyzed by Western blot. The results showed that after administration of Lycii Fructus and Chrysanthemi Flos at different ratios, the model group showed improved retinal thinning and disordered arrangement of retinal layers, elevated content of SOD and GSH in the serum and ocular tissues, and reduced levels of MDA, TNF-α, IL-1β, and IL-6. Lycii Fructus and Chrysanthemi Flos at 1∶1 and 1∶3 showed better improvement effects. The combination significantly upregulated the expression levels of Nrf2 and HO-1 and downregulated the expression of NF-κB p65. These results indicate that Lycii Fructus and Chrysanthemi Flos at different ratios can improve retinal damage, reduce oxidative stress, and alleviate inflammation in both the body and ocular tissues of mice. The mechanism may be related to the regulation of the Nrf2/HO-1 and NF-κB signaling pathways in ocular tissues. These findings provide a theoretical basis for the clinical application of Lycii Fructus and Chrysanthemi Flos in the treatment of dry age-related macular degeneration.
Animals
;
Mice
;
Retina/injuries*
;
Male
;
Lycium/chemistry*
;
Drugs, Chinese Herbal/administration & dosage*
;
Chrysanthemum/chemistry*
;
NF-kappa B/genetics*
;
Humans
;
Retinal Diseases/metabolism*
;
NF-E2-Related Factor 2/metabolism*
;
Oxidative Stress/drug effects*
;
Flowers/chemistry*
;
Heme Oxygenase-1/genetics*
4.Air pollution exposure associated with decline rates in skeletal muscle mass and grip strength and increase rate in body fat in elderly: a 5-year follow-up study.
Chi-Hsien CHEN ; Li-Ying HUANG ; Kang-Yun LEE ; Chih-Da WU ; Shih-Chun PAN ; Yue Leon GUO
Environmental Health and Preventive Medicine 2025;30():56-56
BACKGROUND:
The effect of air pollution on annual change rates in grip strength and body composition in the elderly is unknown.
OBJECTIVES:
This study evaluated the effects of long-term exposure to ambient air pollution on change rates of grip strength and body composition in the elderly.
METHODS:
In the period 2016-2020, grip strength and body composition were assessed and measured 1-2 times per year in 395 elderly participants living in the Taipei basin. Exposure to ambient fine particulate matters (PM2.5), nitric dioxide (NO2), and ozone (O3) from 2015 to 2019 was estimated using a hybrid Kriging/Land-use regression model. In addition, long-term exposure to carbon monoxide (CO) was estimated using an ordinary Kriging approach. Associations between air pollution exposures and annual changes in health outcomes were analyzed using linear mixed-effects models.
RESULTS:
An inter-quartile range (4.1 µg/m3) increase in long-term exposure to PM2.5 was associated with a faster decline rate in grip strength (-0.16 kg per year) and skeletal muscle mass (-0.14 kg per year), but an increase in body fat mass (0.21 kg per year). The effect of PM2.5 remained robust after adjustment for NO2, O3 and CO exposure. In subgroup analysis, the PM2.5-related decline rate in grip strength was greater in participants with older age (>70 years) or higher protein intake, whereas in skeletal muscle mass, the decline rate was more pronounced in participants having a lower frequency of moderate or strenuous exercise. The PM2.5-related increase rate in body fat mass was higher in participants having a lower frequency of strenuous exercise or soybean intake.
CONCLUSIONS
Among the elderly, long-term exposure to ambient PM2.5 is associated with a faster decline in grip strength and skeletal muscle mass, and an increase in body fat mass. Susceptibility to PM2.5 may be influenced by age, physical activity, and dietary protein intake; however, these modifying effects vary across different health outcomes, and further research is needed to clarify their mechanisms and consistency.
Humans
;
Hand Strength
;
Aged
;
Male
;
Female
;
Environmental Exposure/adverse effects*
;
Follow-Up Studies
;
Taiwan
;
Air Pollution/adverse effects*
;
Particulate Matter/adverse effects*
;
Muscle, Skeletal/drug effects*
;
Air Pollutants/adverse effects*
;
Ozone/adverse effects*
;
Aged, 80 and over
;
Adipose Tissue/drug effects*
;
Body Composition/drug effects*
;
Nitrogen Dioxide/adverse effects*
5.Advantages of Chinese Medicines for Diabetic Retinopathy and Mechanisms: Focused on Inflammation and Oxidative Stress.
Li-Shuo DONG ; Chong-Xiang XUE ; Jia-Qi GAO ; Yue HU ; Ze-Zheng KANG ; A-Ru SUN ; Jia-Rui LI ; Xiao-Lin TONG ; Xiu-Ge WANG ; Xiu-Yang LI
Chinese journal of integrative medicine 2025;31(11):1046-1055
6.A critical role for Phocaeicola vulgatus in negatively impacting metformin response in diabetes.
Manyun CHEN ; Yilei PENG ; Yuhui HU ; Zhiqiang KANG ; Ting CHEN ; Yulong ZHANG ; Xiaoping CHEN ; Qing LI ; Zuyi YUAN ; Yue WU ; Heng XU ; Gan ZHOU ; Tao LIU ; Honghao ZHOU ; Chunsu YUAN ; Weihua HUANG ; Wei ZHANG
Acta Pharmaceutica Sinica B 2025;15(5):2511-2528
Metformin has been demonstrated to attenuate hyperglycaemia by modulating the gut microbiota. However, the mechanisms through which the microbiome mediates metformin monotherapy failure (MMF) are unclear. Herein, in a prospective clinical cohort study of newly diagnosed type 2 diabetes mellitus (T2DM) patients treated with metformin monotherapy, metagenomic sequencing of faecal samples revealed that Phocaeicola vulgatus abundance was approximately 12 times higher in nonresponders than in responders. P. vulgatus rapidly hydrolysed taurine-conjugated bile acids, leading to ceramide accumulation and reversing the improvements in glucose intolerance conferred by metformin in high-fat diet-fed mice. Interestingly, C22:0 ceramide bound to mitochondrial fission factor to induce mitochondrial fragmentation and impair hepatic oxidative phosphorylation in P. vulgatus-colonized hyperglycaemic mice, which could be exacerbated by metformin. This work suggests that metformin may be unsuitable for P. vulgatus-rich T2DM patients and that clinicians should be aware of metformin toxicity to mitochondria. Suppressing P. vulgatus growth with cefaclor or improving mitochondrial function using adenosylcobalamin may represent simple, safe, effective therapeutic strategies for addressing MMF.
7.Occupational Hazard Factors and the Trajectory of Fasting Blood Glucose Changes in Chinese Male Steelworkers Based on Environmental Risk Scores: A Prospective Cohort Study.
Ming Xia ZOU ; Wei DU ; Qin KANG ; Yu Hao XIA ; Nuo Yun ZHANG ; Liu FENG ; Fei Yue LI ; Tian Cheng MA ; Ya Jing BAO ; Hong Min FAN
Biomedical and Environmental Sciences 2025;38(6):666-677
OBJECTIVE:
We aimed to investigate the patterns of fasting blood glucose (FBG) trajectories and analyze the relationship between various occupational hazard factors and FBG trajectories in male steelworkers.
METHODS:
The study cohort included 3,728 workers who met the selection criteria for the Tanggang Occupational Cohort (TGOC) between 2017 and 2022. A group-based trajectory model was used to identify the FBG trajectories. Environmental risk scores (ERS) were constructed using regression coefficients from the occupational hazard model as weights. Univariate and multivariate logistic regression analyses were performed to explore the effects of occupational hazard factors using the ERS on FBG trajectories.
RESULTS:
FBG trajectories were categorized into three groups. An association was observed between high temperature, noise exposure, and FBG trajectory ( P < 0.05). Using the first quartile group of ERS1 as a reference, the fourth quartile group of ERS1 had an increased risk of medium and high FBG by 1.90 and 2.21 times, respectively (odds ratio [ OR] = 1.90, 95% confidence interval [ CI]: 1.17-3.10; OR = 2.21, 95% CI: 1.09-4.45).
CONCLUSION
An association was observed between occupational hazards based on ERS and FBG trajectories. The risk of FBG trajectory levels increase with an increase in ERS.
Humans
;
Male
;
Adult
;
Blood Glucose/analysis*
;
China
;
Prospective Studies
;
Occupational Exposure/adverse effects*
;
Risk Factors
;
Middle Aged
;
Steel
;
Fasting/blood*
;
Metal Workers
;
East Asian People
8.Increased Tertiary Lymphoid Structures are Associated with Exaggerated Lung Tissue Damage in Smokers with Pulmonary Tuberculosis.
Yue ZHANG ; Liang LI ; Zi Kang SHENG ; Ya Fei RAO ; Xiang ZHU ; Yu PANG ; Meng Qiu GAO ; Xiao Yan GAI ; Yong Chang SUN
Biomedical and Environmental Sciences 2025;38(7):810-818
OBJECTIVE:
Cigarette smoking exacerbates the progression of pulmonary tuberculosis (TB). The role of tertiary lymphoid structures (TLS) in chronic lung diseases has gained attention; however, it remains unclear whether smoking-exacerbated lung damage in TB is associated with TLS. This study aimed to analyze the characteristics of pulmonary TLS in smokers with TB and to explore the possible role of TLS in smoking-related lung injury in TB.
METHODS:
Lung tissues from 36 male patients (18 smokers and 18 non-smokers) who underwent surgical resection for pulmonary TB were included in this study. Pathological and immunohistological analyses were conducted to evaluate the quantity of TLS, and chest computed tomography (CT) was used to assess the severity of lung lesions. The correlation between the TLS quantity and TB lesion severity scores was analyzed. The immune cells and chemokines involved in TLS formation were also evaluated and compared between smokers and non-smokers.
RESULTS:
Smoker patients with TB had significantly higher TLS than non-smokers ( P < 0.001). The TLS quantity in both the lung parenchyma and peribronchial regions correlated with TB lesion severity on chest CT (parenchyma: r = 0.5767; peribronchial: r = 0.7373; both P < 0.001). Immunohistochemical analysis showed increased B cells, T cells, and C-X-C motif chemokine ligand 13 (CXCL13) expression in smoker patients with TB ( P < 0.001).
CONCLUSION
Smoker TB patients exhibited increased pulmonary TLS, which was associated with exacerbated lung lesions on chest CT, suggesting that cigarette smoking may exacerbate lung damage by promoting TLS formation.
Humans
;
Male
;
Tuberculosis, Pulmonary/immunology*
;
Middle Aged
;
Tertiary Lymphoid Structures/pathology*
;
Adult
;
Lung/pathology*
;
Smoking/adverse effects*
;
Smokers
;
Aged
;
Tomography, X-Ray Computed
9.Efficacy Evaluation of Qishen Yizhi Formula in Improving the Learning and Memory Ability of D-Galactose Induced Suba-cute Aging Mice
Yang CHEN ; Ziqiang ZHU ; Yunqing LU ; Jiani ZHENG ; Cheng CAO ; Jiaxiang TONG ; Xuan LI ; Sheng GUO ; Hongjie KANG ; Jinao DUAN ; Yue ZHU
Journal of Nanjing University of Traditional Chinese Medicine 2024;40(2):145-152
OBJECTIVE To evaluate the effect of Qishen Yizhi formula on improving learning and memory ability in D-galactose subcutaneous injection induced subacute aging mice.METHODS Subacute aging mice model mice were developed by D-galactose subcutaneous injection and then treated with positive drug donepezil(2 mg·kg-1·d-1)and Qishen Yizhi formula water extracts in low(1.33 g·kg-1·d-1)and high dose group(2.67 g·kg-1·d-1).The learning and memory abilities of mice were evaluated using Morris water maze and Y maze tests;HE staining was used to examine hippocampal damage in model mice;TUNEL was used to detect apoptosis of mouse hippocampal tissue;ELISA was used to detect the expression levels of oxidative stress factors and inflammatory fac-tors in the mouse hippocampus tissue;Western blot was used to detect the expression of signaling pathway proteins related to apoptosis,oxidative stress and inflammatory stress in the hippocampus of mice.RESULTS The water extract of Qishen Yizhi formula signifi-cantly shortened the latency and distance of model mice for reaching the platform in the water maze test(P<0.01),and significantly increased the number of crossing the platform(P<0.01);increased the exploration time and number of the Y maze new arm in model mice(P<0.05);inhibited the TUNEL fluorescence expression in the hippocampus of model mice(P<0.01);upregulated the activity of the oxidative stress factor superoxide dismutase(SOD)(P<0.05)and glutathione(GSH)content(P<0.05),and downregulated malondialdehyde(MDA)content(P<0.05);reduced interleukin(IL)-1β,IL-6 and tumor necrosis factor(TNF-α)expression levels(P<0.05,P<0.01);decreased the expression of apoptosis signaling pathway proteins Cleaved Caspase-3 and Caspase-3(P<0.05),upregulated the expression of oxidative stress signaling pathway proteins Nrf2 and HO-1(P<0.05),and downregulated the expression of inflammatory stress signaling pathway proteins p-NF-κB and NF-κB(P<0.05).CONCLUSION Qishen Yizhi for-mula can improve the learning and memory ability of subacute aging model mice injected with D-galactose,which may be related to its inhibitory effect on hippocampal oxidative stress and inflammatory stress.
10.Morphologic analysis and measurement of the posterior superior iliac spine of the hip bone in adolescents based on CT three-dimensional reconstruction
Li-Rong SHA ; Zhi-Jie KANG ; Hai-Yan WANG ; Yuan FANG ; Xiao-He LI ; Feng JING ; Kai ZHANG ; Yun-Feng ZHANG ; Yong ZHU ; Tong-Tong YUE
Acta Anatomica Sinica 2024;55(6):721-727
Objective To establish a normal three-dimensional model of the hip bone in adolescents aged 10-19 years old,analyze the morphology and positional parameters of the posterior superior iliac spine of the hip bone among different genders,sides,and ages,which can supplement the study of the anatomical morphology of the hip bone and to provide a reference for the diagnosis of the clinically relevant diseases and for the therapeutic manipulation and localization of the hip bone.Methods Forty adolescent patients aged 10-19 years without previous spinal pelvic diseases were selected,and the pelvic CT image data were collected and imported into Mimics 21.0 software to establish the model.The relative position parameters of the posterior superior iliac spine and the surrounding anatomical landmarks included the length from the posterior superior iliac spine to the anterior superior iliac spine(ab),the length from the tip of the posterior superior iliac spine to the sciatica(ac),the length from the tip of the posterior superior iliac spine to the pubic tubercle(ae),the length from the tip of the posterior superior iliac spine to the midpoint of the posterior margin of the auricular joint surfaces(af),the length from the tip of the posterior superior iliac spine to the iliac spine turn(ag),and the length from the sciatica tubercle to the highest point of the iliac spine(cd).The local parameters of the posterior superior iliac spine included the width(W0)and the thickness(H0)at point A.The maximum width of the posterior iliac spine(WMAX),its distance from point a(D0),and the width of the iliac spine were measured at 0.5,1,and 1.5 cm from point a,and were recorded sequentially as W1,W2,and W3.The width of the iliac spine at the turn of the iliac spine(point g)was measured(W4).The relative positions and parameters of the posterior superior iliac spine to the surrounding anatomical landmarks and the localized parameters of the posterior superior iliac spine were compared sequentially for different genders,sides,and age groups.Results In the measurement result of the parameters of the posterior superior iliac spine and the surrounding anatomical landmarks,the differences in the comparisons between different genders of the ac,ae,and af indexes were statistically significant(P<0.05),and the differences in the comparisons between different genders of the ab,ag,and cd indexes were not statistically significant(P>0.05).The differences in the comparisons between the right and left sides of the ab,ac,ae,af,ag,and cd indexes were not statistically significant(P>0.05).The difference in comparison between different age groups of ab,ac,ae,af,ag,and cd indicators was statistically significant(P<0.05).In the measurement result of the local parameters of the posterior superior iliac spine,the difference in the comparison between the sexes of the W0,W1,W2,WMAX,and H0 indexes was statistically significant(P<0.05),and the difference in the comparison between the sexes of the W3,W4,and D0 indexes was not statistically significant(P>0.05);And the difference in the comparison between the left and right sides of the W0,W1,W2,and the right and left sides of the W3,W4,WMAX,D0,and H0 indexes was not statistically significant(P>0.05);The difference between W0,W1,W2,W3,W4,WMAX,D0,H0 indicators compared between different age groups was not statistically significant(P>0.05).Conclusion Adolescent females have overall greater pelvic parameters than males,with wider and thicker tips of the posterior superior iliac spine in females and narrower and thinner tips of the posterior superior iliac spine in males;Pelvic parameters show a tendency to increase with age,while the width and thickness of the posterior superior iliac spine,as well as the width of the cephalic end to the iliac spine remain essentially unchanged.

Result Analysis
Print
Save
E-mail