1.Retrospective Study on Clinical and Imaging Features of Foot-Yangming Meridian-muscle Syndrome of Knee Osteoarthritis
Journal of Guangzhou University of Traditional Chinese Medicine 2016;33(5):658-661
Objective To investigate the clinical and imaging features of Foot-Yangming meridian-muscle syndrome of knee osteoarthritis(KOA) so as to promote the normalization and standardization of the meridian-muscle therapies. Methods A total of 31 KOA cases (involving 31 knees) of Foot-Yangming meridian-muscle syndrome were included into the study group , and 31 healthy volunteers (involving 31 knees) served as the control group. A retrospective research of patellofemoral relationship was carried out based on the clinical and imaging features. Results The differences of Insall index and patella index between the study group and control group were insignificant(P> 0 . 05), but the differences of patellofemoral index , patellofemoral congruence angle, and external patellar angle between the study group and control group were significant(P<0.01). Conclusion The patellofemoral relationship disorder is one of main lesions in Foot-Yangming meridian-muscle syndrome of KOA.
2.Effects of dexamethasone and latrunculin A on expression of protein in human trabecular meshwork cell
Xianchai LIN ; Minbin, YU ; Xuyang, LIU ; Xuan, QIU ; Kaili, WU
Chinese Ophthalmic Research 2010;28(2):145-148
Background Researches have demonstrated that dexamethasone (Dex) can induce the changes of the function and structure of trabecular meshwork cells,and latrunculin A (Lat A) can enhance the outflow of aqueous humour and therefore low the intraocular pressure.Objective The aim of the present study is to investigate the effects of Dex and Lat A on the expression of protein in human trabecular meshwork cells.Methods Human trabecular meshwork cells were primarily cultured in DMEM using expand culture method and the fifth generation of cells were used to this experiment.Dex and/or Lat A were added in medium as 10~(-6)mol/L Dex group(Dex treating for 24 hours),Dex+Lat A group(10~(-6)mol/L Dex+2mmol/L Lat A for 24 hours),Lat A group(2mmol/L Lat A for 24 hours) and DMEM culture group.Two dimensional gel electrophoresis(2 DE) was used to compare the protein expressions among these four groups.Subsequently protein spots with different intensity were selected for mass spectrometry analysis.Results Four gel patterns of two dimensional gel electrophoresis of human trabecular meshwork cells from Dex,Dex+Lat A,Lat A and control groups were obtained.A good isolated result for majority of proteins in human trabecular meshwork cells was found in all of the four groups.An obvious expression difference of proteins in human trabecular meshwork cells was seen among the different culture conditions.Twenty four kinds proteins were identified by GDPiMALDI TOF MS,including cytoskeleton related proteins,heat shock proteins,redox related proteins,and proteins participating in carbohydrate metabolism.The expressions of aldehyde dehydrogenase(ADLH)and Rab were increased in Lat A group and decreased in Dex group,but HSP27 and hCRMP2 showed the contrary outcome.Conclusion This study construct the pattern of protein expression in human trabecular meshwork cells by using 2 DE.Dex and Lat A impact the protein expressions in human trabecular meshwork cells.
3.Comparative study of DSA vs Gd-EOB-DTPA-enhanced MRI in diagnosing postoperative recurrent tiny HCC lesions
Zanrui SU ; Yunfu HUANG ; Jianjun LIN ; Yu LONG ; Xuan CHEN ; Zuhua LIN ; Feng LI
Journal of Interventional Radiology 2017;26(6):559-563
Objective To compare the diagnostic value of DSA with that of Gd-EOB-DTPA-enhanced MRI for postoperative recurrent tiny hepatocellular carcinoma (HCC) lesions.Methods The clinical data of a total of 38 patients,who were admitted to authors' hospital during the period from September 2011 to March 2016 as clinically they were suspected to have postoperative recurrent tiny HCC lesions,were retrospectively analyzed.DSA,DSA plus lipiodol CT scan and Gd-EOB-DTPA-enhanced MRI were performed in all patients.The positive and negative diagnosis rates were compared among different examination methods,the diagnostic sensitivity and specificity were calculated.The imaging diagnosis of each patient was made by two associationchief radiologists independently,both the pathological findings from surgery or puncture biopsy and the 6-month follow-up results were taken as the final diagnosis basis.Results A total of 47 lesions were detected in the 38 patients.The diameter of the lesions was 0.5-2.0 cm,with an average of (1.2+0.8) cm.Of the 47 lesions,41 were proved to be recurrent tiny HCC lesions.Among the 41 lesions,22 had pathological evidence,and the remaining 19 lesions were confirmed through clinical follow-up.Six lesions were non-HCC focus,which were proved by clinical follow-up.For all lesions,the diagnostic sensitivity and specificity were 72.2% and 80.0% respectively by conventional DSA,which were 90.2% and 100% respectively by DSA plus lipiodol CT scan,and were 95.1% and 100% respectively by Gd-EOB-DTPA-enhanced MRI.Statistical analysis indicated that significant differences in diagnostic sensitivity and specificity existed between conventional DSA and DSA plus lipiodol CT scan as well as between conventional DSA and Gd-EOB-DTPA-enhanced MRI (P<0.05),while the differences in diagnostic sensitivity and specificity between DSA plus lipiodol CT scan and Gd-EOB-DTPA-enhanced MRI were not statistically significant (P>0.05).Conclusion For the detection of postoperative recurrent tiny HCC lesions,DSA plus lipiodol CT scan has quite the same diagnostic value as Gd-EOB-DTPA-enhanced MRI does.For patients who are not suitable to receive MRI examination,the use of DSA plus lipiodol CT scan,as an alternative means of inspection,should be taken into consideration.
4.Retroperitoneal laparoscopic adrenalectomy: 21 cases
Lin XIONG ; Qian ZOU ; Shuyong YU ; Hongfeng SHEN ; Wei LI ; Geng HE ; Xuan KANG
Journal of Endocrine Surgery 2011;05(6):406-407
Objective To evaluate clinical efficacy of retroperitoneal laparoscopic adrenalectomy in patients with adrenal disease.Methods 21 cases of adrenal disease undergoing retroperitoneal laparoscopic adrenalectomy from Jun.2006 to Oct.2010 were retrospectively reviewed.Results All operations were performed successfully except 2 cases were converted to open surgery due to peritoneal rupture,which resulted in difficult exposure of retroperitoneal cavity.The operation time ranged from 55 to 300 minutes,with 90 minutes as the medium.Blood loss volume ranged from 10 to 100 ml during operation (30 ml as the medium ).No blood transfusion was given.No complication such as massive hemorrhage,infection,abdominal visceral injury etc.occurred.19 patients were treated successfully and followed up from 3 to 55 months with 12.3 months as the medium.No tumor recurrence and metastasis was found in the 19 cases.Conclusion Retroperitoneal laparoscopic adrenalectomy has advantages of high safety,less complications and satisfactory efficacy in patients with adrenal diseases.
5.Predictive Effect of Mean Platelet Volume in Patients with Portal Vein Thrombosis: A Meta-analysis of Case-control Studies
Wen-Yi LIN ; Xuan LU ; Feng-Juan FAN ; Yu HU
Journal of Huazhong University of Science and Technology (Medical Sciences) 2018;38(4):575-581
Mean platelet volume (MPV) is an early marker of platelet activation.Larger platelets,compared to small ones,increase platelet adhesion and aggregation,and present a higher thrombotic activity.Some studies have explored the association between MPV and the morbidity of portal vein thrombosis (PVT).The aim of this study was to evaluate the predictive effect of MPV in patients with PVT by a meta-analysis.We searched Pubmed,Web of Science,SCOPUS,OVID,CNKI and CBMD from database inception to September 13,2017.Seven studies in accordance with selection criteria were included.The extraction of basic data was independently conducted by two reviewers.The mean difference in MPV between PVT patients and controls were pooled with weighted mean difference (WMD)and 95% confidence interval of 0.88 fl (95% CI:0.61-1.15).A random-effect model was chosen for an obvious heterogeneity in the pooling (Chi-square=27.12,df=6,P<0.0001,I2=77.9%).The sources of heterogeneity were from the difference of primary disease of participants and portal vein diameter.Taken together,our results reveal that MPV is a predictive indicator in patients with PVT.
6.A semantic processing development study in 7-11 years old children with attention deficit hyperactivity disorder and normal children:an ERP study of N400
Fangqiao ZHAO ; Xuan DONG ; Huijuan SHEN ; Lin CHEN ; Kaihua JIANG ; Yu DONG
Chinese Journal of Behavioral Medicine and Brain Science 2016;25(3):235-239
Objective To explore the developmental characteristics of semantic processing of chil-dren with attention deficit hyperactivity disorder( ADHD) by comparing the event related potential in normal children and ADHD children ( ages 7-11 years old) .Methods 83 ADHD children and 93 normal children ranging from 7 to 11-year were divided into 5 groups to analyze the difference of the amplitude and latency of ERP N400 in three conditions:the related,unrelated and pesudoword after the Chinese character word visual stimulus task.Results (1) The related condition:the amplitude of the 7 years old normal children group was higher than 11 years old((-10.67±4.39)μV,(-4.62±3.55)μV;P=0.005);and the amplitude was highest in 8 years old group in children with ADHD( (-10.77±6.66) ms, F=2.54, P=0.046) .The latency in normal children was shorter at 8 years old((311.7±33.1) ms, P<0.05),but was shorter at 9 years old in ADHD group.( 2) The unrelated condition:the amplitude of normal children aged 10 years was higher than that of other age groups.( 3) The pesudoword condition:the amplitude of 9 years old normal children was higher than other age groups.The amplitude of ADHD in children aged 9 years was higher than that in other age groups( (-16.08±7.14)μV, P<0.05) .Conclusion In the semantic related conditions,the amplitude of the N400 in ADHD children at the age of 8 and the latency at the age of 9 are significantly developed,and in the false words conditions,it is at the age of 11.This suggests that the ability of 7-11 years old ADHD chil-dren's orthographic semantic processing and cognitive development are slower than normal.N400 can better reflect the children's early language cognitive ability,and it is valuable for the early diagnosis of children with ADHD.
7.Phenolic acid compounds from Phellodendron chinense and their activity on α -glucosidase inhibition
Yu-lin ZHANG ; Si-qi LI ; Lan-zhu ZHU ; Xuan-qin CHEN
Acta Pharmaceutica Sinica 2024;59(11):3130-3134
The non-alkaloid chemical constituents of dried
8.Relationship between collagen Ⅰ,MMP-2 and TIMP-2 gene expression and atrial fibrosis and fibrillation during heart failure in dogs.
Ya-Zhou LIN ; Lin CHEN ; Chun-Xuan XU ; Yu-Lian DENG ; Xiao-Dan WU ; Bin CHEN ; Xi-Zhong HU ;
Chinese Journal of Geriatrics 1995;0(02):-
Objective To study the relationship between Couagen Ⅰ,MMP-2,TIMP-2 gene expression and atrial fibrosis during heart failure(HF)in dog.Methods Fourteen dogs were used and randomized into HF induced by ventricular tachypacing and control group.Burst atrial pacing was used to induce atrial fibrillation(AF).And the mRNA and protein level of collagen Ⅰ,MMP-2 and TIMP-2 were detected by RT-PCR and immunohistochemical technique.Tissue samples were stained with Mallory trichrome.Results Left ventricular ejection fraction (LVEF) decreased from (67.4? 6.0)% to (29.2?7.8)%,the inducible rate of AF(7/7 vs 2/7) and sustained AF(5/7 vs 0/7) increased and duration of AF stabeatrial fibrillation(SAF) [(462.12?181.43)s vs(0.57?0.57) s] prolonged significantly in HF group.Atrial fibrous tissue content and atrial size of HF group were significantly greater than the controls dogs(268.8% in lefe atria and 190.3% in right atria).The mRNA and protein level of collagen Ⅰ(56.2% and 132.2% in lefe atria,37.4% and 78.0% in right atria)and MMP-2 (100.0% and 115.7% in lefe atria,65.7% and 96.8% in right atria) increased evidently in both lefe atria and right atria,TIMP-2 mRNA decreased 46.3% in lefe atria and had no change in right atria and that its protein had no change in both atrium,whereas the ratio of MMP-2/ TIMP-2 of mRNA and protein increased markedly in both lefe atria (285.3% and 148.8%)and right atria (106.1% and 134.7%)of HF group.SAF had a positive correlation with fibrosis and the gene level of collagen Ⅰ in lefe atria,the ratio of MMP-2/TIMP-2 had a positive correlation with fibrosis and collagen Ⅰ gene level in lefe atria during HF.Conclusions The changes of collagen Ⅰ,MMP-2 and TIMP-2 gene expression appear to be a molecular mechanism of AF, and the molecular remodeling of collagen Ⅰ induced by regulation unbalance of MMP-2/TIMP-2 appears to be an important mechanism of atrial fibrosis during HF.
9.Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis
Zhu JI-TING ; Lin HAN ; Wu XUAN ; Li ZHI-WEN ; Lin AI-YU
Chinese Medical Journal 2019;132(23):2827-2834
Background: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATITA-GAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOV A)in R software.Results: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each <1.41%).ITS genotype was 4efined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P = 0.0014)between infectious group and control group was observed.Conclusions: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.
10.Identification of constituents in vitro and blood-absorbed ingredients of protective effect on acute liver injury from Yin Chen Hao decoction based on UPLC-QTOF/MS
Yi-qing YAO ; Qi CAO ; Xuan WANG ; Hui-lin MA ; Yu-miao CHEN ; Si-yi ZHAO ; Min-xuan GUO ; Jia-meng HU ; Dong-yao WANG ; Di-ya LÜ
Acta Pharmaceutica Sinica 2023;58(5):1173-1180
To identify the active constituents