A rapid method for the simultaneous determination of daidzein, genistein and formonetin in Solanum Lyratum Thunb by high performance liquid chromatography (HPLC) was developed. Separation was achieved on a Diamonsil C18 column (250 mm X 4.6 mm, 5 μm) with isocratic elution, using a mobile phase of methanol-tetrahydrofuran-water (44:3:53, v/v). The wavelength was set at 260 nm and column was maintained at 35°C. The linear ranges of daidzein, genistein and formonetin were 1.0-40.0, 0.1-4.0 and 0.1-4.0 μg/mL, respectively. The average recoveries were between 98.4% and 101.3 %. This method could be used for the quality control of Solanum lyratum Thunb due to its simplification, reliability, rapidity and excellent precision.

A rapid method for the simultaneous determination of daidzein, genistein and formonetin in Solanum Lyratum Thunb by high performance liquid chromatography (HPLC) was developed. Separation was achieved on a Diamonsil C18 column (250 mm X 4.6 mm, 5 μm) with isocratic elution, using a mobile phase of methanol-tetrahydrofuran-water (44:3:53, v/v). The wavelength was set at 260 nm and column was maintained at 35°C. The linear ranges of daidzein, genistein and formonetin were 1.0-40.0, 0.1-4.0 and 0.1-4.0 μg/mL, respectively. The average recoveries were between 98.4% and 101.3 %. This method could be used for the quality control of Solanum lyratum Thunb due to its simplification, reliability, rapidity and excellent precision.

Animals ; Apoptosis ; Hypoxia-Inducible Factor 1, alpha Subunit ; Hypoxia-Ischemia, Brain ; genetics ; pathology ; Neurons ; cytology ; metabolism ; RNA, Messenger ; analysis ; Rats ; Rats, Sprague-Dawley ; Transcription Factors ; genetics

Objective To observe the preventive efficacy and safety of dexmedetomidine with parecoxib sodium on the patients with postoperative hyperalgesia induced by remifentanil. Methods A total of 100 female patients undergoing elective surgery under general anesthesia were as-signed into four groups according to the table of random number:the control group (group C),the parecoxib sodium group (group P),the dexmedetomidine group (group D)and the parecoxib sodium combined with the dexmedetomidine group (group DP).The vital signs were monitored and the total intravenous anesthesia was performed.All the patients were give intravenous injection of 0.2μg·kg-1 ·min-1 remifentanil and 4-12 mg·kg-1 ·h-1 propofol to maintain the anesthesia.Patients in group P were given 40 mg parecoxib sodium 30 minutes before the end of the operation.Patients in group D were give intravenous injection of 0.6μg·kg-1 ·min-1 dexmedetomidine consistently till 30 min before the end of the operation.Patients in group DP were given 0.6 μg·kg-1 ·min-1 till 30 min before the end of the operation and were given 40 mg parecoxib sodium.The VAS scores were re-corded at 1,2,6,12,24 hours.The cases of agitation,rigors,nausea and vomiting and increasing of analgesics were recorded.Results The postoperative VAS scores in group P,group D and group DP were significantly lower than group C(P <0.05).The postoperative VAS scores in group DP were significantly lower in group P and group D (P<0.05).Cases of agitation and rigors in group D and group DP were less than group C(P <0.05).The increasing of analgesics in group DP was much higher than other groups(P<0.05).Conclusion After induced,patients were given intravenous in-jection of 0.6 μg·kg-1 ·min-1 dexmedetoniding consistently till 30 min before the end of the opera-tion were given 40 mg parecoxib sodium can effectively prevent hyperalgesia after remifentanil anes-thesia without significant increase in revival time and obtain a better sedation.

After a description of the characteristics of novelty assessment of literature on information technology involving different subjects, multiple new technologies and deep knowledge, the strategies were elaborated for it.

Animals ; Animals, Newborn ; Brain ; metabolism ; pathology ; Caspase 3 ; Caspases ; metabolism ; DNA-Binding Proteins ; genetics ; Gene Expression ; Hypoxia, Brain ; genetics ; physiopathology ; Hypoxia-Inducible Factor 1 ; Hypoxia-Inducible Factor 1, alpha Subunit ; Immunohistochemistry ; Ischemic Preconditioning ; Nuclear Proteins ; genetics ; RNA ; genetics ; metabolism ; Random Allocation ; Rats ; Rats, Sprague-Dawley ; Reverse Transcriptase Polymerase Chain Reaction ; Transcription Factors

Objective To compare the laboratory and clinical results between unstimulated in vitro maturation (IVM) and IVM converted from in vitro fertilization (IVF) in polycystic ovarian syndrome (PCOS) and non-PCOS patients.Methods We divided 591 IVM cycles in the First Affiliated Hospital of Wenzhou Medical Univesity from Jan.2008 to Dec.2013 into 4 groups:group A1B1,PCOS patients underwent unstimulated IVM protocol,240 cycles; group A1B2,PCOS patients underwent IVM converted from conventional stimulated IVF protocol,153 cycles; group A2B1,non-PCOS patients underwent unstimutlated IVM protocol,103 cycles; group A2B2,non-PCOS patient underwent IVM converted from conventional stimulated IVF protocol,95 cycles.Multiple linear regression method and binary logistic regression method were used to assess the influence of PCOS and protocols for IVM on laboratory and clinical outcomes.Results The mean number of oocytes retrieved was positively related with PCOS [partial regression coefficient (B)=3.37,P＜0.01].The maturation rate of oocytes was positively related with hCG-prime prior to oocyte aspiration (B=0.05,P=0.010).High-quality embryo rate was positively related with PCOS and IVM converted from IVF (B=0.08,P=0.010; B=0.09,P=0.001),as well as implantation rate related with them (B=0.07,P=0.010; B=0.10,P＜0.01).PCOS and IVM converted from IVF improved hCG positive (hCG＞10 U/L) rate (OR=1.636,95％CI:1.113-2.204,P＜0.05; OR=1.861,95％CI:1.307-2.649,P＜0.05) and the clinical pregnancy rate (OR=1.507,95％CI:1.041-2.240,P＜0.05; OR=1.881,95％CI:1.312-2.696,P＜0.05).IVM converted from IVF protocol decreased the spontaneous abortion rate (OR=0.490,95％CI:0.245-0.978,P＜0.05).Multiple gestation rate and ectopic pregnancy rate were not affected by PCOS condition and protocol used (P＞0.05).Conclusions PCOS and IVM converted from IVF protocol improved the high-quality embryo rate,implantation rate,hCG positive rate and clinical pregnancy rate.IVM converted from IVF protocol reduced the spontaneous abortion rate.PCOS patients may be more suitable for the IVM treatment.No matter PCOS or non-PCOS patients,IVM converted from IVF protocol had better pregnancy outcome than that of unstimulated cycle.

Objective To study the effect of human cytomegalovirus (HCMV) on expressions of K8 and K18 in duct epithelial cells of salivary gland. Methods The expressions of immediate early antigen of HCMV, K8 and K18 were detected by immunohistochemistry staining in tissues embedded in paraffin of parotid cytomegalic inclusion disease(PCID). Results Cytomegly bearing inclusion appeared in duct epithelium of PCID. DDG9/CCH2 antigen of HCMV was expressed in cytomegly bearing inclusion. K8 was negative in these cytomegly while K18 was intensively positive. Conclusion It is suggested that breaking down of K8 be induced in parotid duct epithelial cells infected by HCMV and that up-regulation of K18 may be a reactive change. Keratin network in simple epithelium functions to impart mechanical integrity to cells.

Child ; Child, Preschool ; Female ; Humans ; Infant ; Infant, Newborn ; Intracranial Hemorrhages ; etiology ; pathology ; Magnetic Resonance Imaging ; Prognosis ; Tomography, X-Ray Computed

Vascular-resided bacterial and fungal diseases have caused a great deal of yield loss and quality reduction in crop production world-wide. For genetic engineering of crops resistant to these diseases, it is disirable to have a strong and vascular-specific promoter. This article reviews the progress in identification of vascular-specific promoters and its function. To date, roughly twenty vascular-specific promoters have been documented. The cis-elements and motifs have been studied in detail for the promoters of bean phenylalanine ammonia lyase (PAL2), bean glycine-rich protein (grp 1.8) and Arabidopsis profilin2 (pfn2) in particular.The motif of vs-1 (CATGCTCCGTTGGATGTGGAAGACAGCA) found in grp 1.8 promoter was a cis-element that specificically bind to a transcription activation factor VSF-1 protein (one of the bZIP proteins). Mutation of vs-1 prevented it from binding to VSF-1 that resulted in abolishing the vascular-specific expresson of gus gene. Motifs of AC-I and AC-II found in PAL2 promoter were also found to be essential for vascular-specific expression. In our laboratory we have dissected pfn2 promoter into three domains (A, B, C) through 5'-deletion analysis. In this promoter we have identified two core sequences of ACGT that is commonly found in the binding sites of bZIP protein, the most abundent transcription factor existed in plants. In additon, the pfn2 promoter also contains an AC- I like sequence (CCACCTAC) that is similar to the AC- I motif (CCCACCTACC) found in PAL2 promoter. These promoters and cis-elements may have a wide range of potential applications to the genetic improvement of crops resistant to vascular diseases.
Gene Expression Regulation, Plant ; genetics ; physiology ; Phenylalanine Ammonia-Lyase ; genetics ; Plant Proteins ; genetics ; Promoter Regions, Genetic ; genetics ; Regulatory Sequences, Nucleic Acid ; genetics