1.Complications of cervical artificial disc replacement.
China Journal of Orthopaedics and Traumatology 2015;28(10):975-978
Cervical artificial disc replacement (CADR) as a new method for the treatment of cervical spondylosis, is becoming a basic and clinical research. Compared with the anterior cervical discectomy and fusion (ACDF), the biggest difference of CADR lies in the reconstruction of the cervical vertebra height and physiological curvature, retaining the spinal physiological function maximally and reducing the degenerative changes in adjacent segments. A large number of clinical investigation have suggested that ACDR can become an operation method to replace the ACDF. However, the complications and the problems of prosthesis itself are gradually exposed, such as that the prosthesis, can't completely simulate the biological effects of human intervertebral disc, the other factors and including the operation methods and prosthesis itself. At the same time, the problem that how to prevent complications and problems is required to be solved. Whether, the effect of CADR on the activity of the operation segment, and the prevention of adjacent segment degeneration can be guaranteed for a long time has drawn more and more attention from scholars.
Cervical Vertebrae
;
surgery
;
Humans
;
Postoperative Complications
;
etiology
;
Total Disc Replacement
;
adverse effects
2.The effect of PTEN expression downregulation on biological characteristics of breast cancer cell line
Xiaoxin JI ; Chengyu LUO ; Deming YU ; Xuan WU
Chinese Journal of General Surgery 2014;29(1):49-53
Objective To investigate expression of the phosphatase and tensin homolog (PTEN) gene in breast cancer cell line and its effect on biologic characteristics.Methods The normal PTEN expression cell line MDA-MB-231 (M231) was used in this study.PTEN-shRNA plasmid was transected into M231 breast cancer cells to knock down the expression of PTEN.The changes of PTEN expression,proliferation,invasion and metastasis of PTEN knocked down cell were tested by RT-PCR,Western blot,CCK-8,scratch and Transwell.Results PTEN-shRNA was successfully transected into M231 cells.PTEN mRNA and protein expression was efficiently inhibited in M231-3001 cell lines than that in control group M231-scr(P < 0.01),M231-3001 cell lines showed a greater capability of colony formation,migration and invasion than that in control group M231-scr (all P < 0.05).Conclusions PTEN,as a suppression gene,its low expression can promote the proliferation,migration and invasion of breast cancer cells.
3.Prevention of Hepatitis B Virus Reinfection after Liver Transplantation
Xianjie SHI ; Ningxin ZHOU ; Wenbin JI ; Weidong DUAN ; Tao YANG ; Maosheng SU ; Qiang YU ; Xuan ZHANG
Chinese Journal of Nosocomiology 2006;0(05):-
OBJECTIVE To discuss the preventive methods of hepatitis B virus reinfection after liver transplantation. METHODS Eighty eight liver transplantation recipients with HBV-related end-stage liver diseases including chronic fulminant hepatitis B,end-stage liver cirrhosis and liver carcinoma were analyzed retrospectively,and were given lamivudine pre-transplantation to prevent hepatitis B virus reinfection.Post-transplantation medicines of lamivudine were administered in 3 cases;lamivudine and hepatitis B immunoglobulin(HBIg) in 85 cases.The follow-up criteria included serum HBV,HBV-DNA,liver biopsy,immunohistochemical study of liver biopsy specimens and clinical manifestations.All of patients were followed-up 6 months at least.RESULTS Two of the three cases who taken lamivudine developed reinfection,the little time is 6 months following liver transplantation.There were three of eighty five cases taken lamicudine and HBIg(small dosage) developed reinfection.CONCLUSIONS Liver transplantation is an effective treatment for HBV-related end-stage liver diseases.Given lamivudine at the pre-transplantation could reduce the levels of the HBV virus copies.Lamivudine and HBIg post-transplantation offer effective prevention against hepatitis B virus reinfection.
4.Research progress in characteristics of conjunctiva goblet cells and its relationship with ocular surface health
Yu, ZHONG ; Ji-Kai, ZHU ; Lu-Xuan, WANG ; Jing-Dong, XU
International Eye Science 2017;17(9):1667-1670
Conjunctiva goblet cells are spread out within a stratified epithelium, and keep ocular surface homeostasis by secreting mucin.Previous research has shown conjunctiva goblet cells can secret mucin, remove debris and modulate ocular surface immune function.In this review, we will focus on biological characteristics of conjunctiva goblet cells and the effect of key factors SAM pointed domain Ets factor(SPDEF) on differentiation and function of conjunctiva goblet cells, and further understand relationship between goblet cells and eye health.
5.Metabolomic approach to evaluating the effect of the mixed decoction of kelp and licorice on system metabolism of SD rats.
Run-bin SUN ; Xiao-yi YU ; Yong MAO ; Chun GE ; Yang NA ; Ji-ye A ; Yu-ping TANG ; Jin-ao DUAN ; Zi-teng MA ; Xu-tong WU ; Xuan-xuan ZHU ; Guang-ji WANG
Acta Pharmaceutica Sinica 2015;50(3):312-318
The aim of the study is to evaluate the effects of the single and mixed decoction of Thallus laminariae (kelp) and Glycyrrhiza glabra (licorice) on the metabolism and their difference. The mixed decoction of kelp and licorice and the single decoction were made and intragastrically administered to the SD rats. The effect on system metabolism, the toxicity of liver and kidney were assessed by GC-MS profiling of the endogenous molecules in serum, routine biochemical assays and histographic inspection of tissues from SD rats, separately. The mixed decoction of kelp and licorice induced more obvious pathological abnormalities in SD rats than a single decoction of kelp, while the extracts of licorice did not show any pathological change. Neither the mixed, nor the single decoction showed abnormal histopathology. After intragastric administration of extracts for 5 days, the mixed decoction induced a decrease of ALT (no significant change in the groups of single decoction) and an increase of BUN (so did the single decoction of kelp). Metabolomic profile of the molecules in serum revealed that the metabolic patterns were all obviously affected for the three groups, i.e., the mixed and single decoction of kelp and licorice. The rats given with the single decoction of kelp showed a similar pattern to that of the mixed decoction, indicating that the kelp primarily contributed the perturbation of metabolism for the mixed decoction. All three groups induced a decrease of branched chain amino acids, TCA cycle intermediates and glycolysis intermediates (e.g., pyruvic acid and lactic acid) and an increase of 3-hydroxybutyric acid. Kelp decoction showed stronger potential in reducing TCA cycle intermediates and glycolysis intermediates than the other two groups, while the levels of branched chain amino acids were the lowest after licorice extracts were given. These results suggested that the effect of the mixed decoction on metabolism was closely associated with both kelp and licorice. The continuous administration of single decoction of kelp and the mixed decoction of licorice and kelp resulted in pathological abnormalities in kidney of SD rats. The mixed decoction of kelp and licorice distinctly perturbed sera molecules and hence system metabolism, which showed associated with those of kelp and licorice. Although the metabolic effect was associated with both kelp and licorice, the results suggested kelp contributed to it primarily.
Animals
;
Glycyrrhiza
;
chemistry
;
Kelp
;
chemistry
;
Kidney
;
drug effects
;
Liver
;
drug effects
;
Metabolomics
;
Plant Preparations
;
pharmacology
;
Rats
;
Rats, Sprague-Dawley
6.Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis
Zhu JI-TING ; Lin HAN ; Wu XUAN ; Li ZHI-WEN ; Lin AI-YU
Chinese Medical Journal 2019;132(23):2827-2834
Background: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATITA-GAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOV A)in R software.Results: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each <1.41%).ITS genotype was 4efined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P = 0.0014)between infectious group and control group was observed.Conclusions: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.
7.Coexistence of High Fibrinogen and Low High-density Lipoprotein Cholesterol Levels Predicts Recurrent Cerebral Venous Thrombosis.
Xin MA ; Xun-Ming JI ; Paul FU ; Yu-Chuan DING ; Qiang XUE ; Yue HUANG
Chinese Medical Journal 2015;128(13):1732-1737
BACKGROUNDCerebral venous thrombosis (CVT) may lead to serious neurological disorders; however, little is known about the risk factors for recurrent CVT. Our aim was to determine the association between elevated fibrinogen and decreased high-density lipoprotein cholesterol (HDL-C) levels with recurrent CVT.
METHODSThis retrospective cohort study included participants if they had a first episode of objectively defined CVT and were admitted to Xuan Wu Hospital, Capital Medical University from August 2005 to September 2009. Demographic and clinical variables were collected, as well as laboratory parameters, including plasma fibrinogen and HDL-C. Patients with CVT were followed for recurrent symptomatic CVT. Follow-up was through the end of September 2010. Potential predictors of recurrence were analyzed using Cox survival analysis.
RESULTSAt the end of the follow-up, 95 patients were eligible for the study. Twelve of 95 patients (12.6%) had recurred CVT. The median time of recurrence was 7 months (range: 1-39 months). Eight of these 12 (66.7%) experienced recurrence within the first 12 months after their initial CVT. The recurrence rate of CVT was 2.76 per 100 patient-years. Multivariate Cox regression analysis demonstrated that the coexistence of high fibrinogen (>4.00 g/L) and low HDL-C (<1.08 mmol/L) levels at baseline was the only independent predictor for recurrent CVT (hazard ratio: 4.69; 95% confidence interval: 1.10-20.11; P < 0.05). Of the twelve patients with recurrent CVT in our study, 7 (58.3%) had high fibrinogen plus low HDL-C levels. All 7 of these patients took warfarin for 3-12 months, and 6 of 7 had recurrent CVT after the discontinuation of anticoagulant treatment.
CONCLUSIONSConcomitant high fibrinogen and low HDL-C levels may be associated with recurrence of CVT. The effect of potential risk factors related to atherothrombosis on recurrent CVT should be closely monitored.
Adolescent ; Adult ; Aged ; Cholesterol, HDL ; metabolism ; Cohort Studies ; Female ; Fibrinogen ; metabolism ; Humans ; Intracranial Thrombosis ; metabolism ; pathology ; Male ; Middle Aged ; Recurrence ; Retrospective Studies ; Young Adult
8.Chronic effects of transmyocardial laser revascularization combined with off-pump coronary artery by pass (OPCAB) compared with OPCAB alone in patients with ischemic heart disease: a prospective multicenter follow-up study.
Hong ZHAO ; Feng WAN ; Jing-xuan GUO ; Yu CHEN ; Ji-yan XIE ; Wei YANG ; Ping ZHANG
Chinese Journal of Cardiology 2006;34(8):710-713
OBJECTIVETo approach the long term safety and efficacy of transmyocardial laser revascularization (TMLR, holmium: YAG) combined with off-pump coronary artery bypass (OPCAB) compared with OPCAB alone in patients with ischemic cardiac disease.
METHODSBetween 1999 and 2005, 80 patients with diffusely diseased target vessels from two centers in Beijing were enrolled to the study and randomized to receive either TMLR/OPCAB (n = 40) or OPCAB (n = 40) operation. Baseline demographics and operative characteristics were similar between groups. Follow-up (mean 3.4 +/- 1.7 years) included CCS angina class and NYHA classification assessments, 6 minutes walking test (6MWT) and echocardiography.
RESULTSPerioperative mortality was 5% in both groups. No death occurred during follow up. At the end of follow-up, patients at both groups experienced significant improvement on angina score compared with baseline, and angina score was also significantly lower (1.21 +/- 0.42 vs. 1.57 +/- 0.87, P = 0.03) and 6MWT-distance significantly increased (518.0 +/- 65.5 m vs. 473.8 +/- 65.8m, P = 0.006) in OPCAB/TMLR group than that in the OPCAB group. Fewer patients developed recurrent severe angina and received re-CABG/PCI in OPCAB/TMLR group than that in the OPCAB (1 vs. 6 cases, P = 0.113). NYHA and LVEF were similar between the groups at the end of follow up.
CONCLUSIONOur study showed that the addition of TMLR to OPCAB is superior in improving angina and exercise tolerance, but there is no further improvement in cardiac function compared to OPCAB alone.
Aged ; Angioplasty, Laser ; Combined Modality Therapy ; Coronary Artery Bypass, Off-Pump ; Coronary Disease ; therapy ; Female ; Follow-Up Studies ; Humans ; Male ; Middle Aged ; Myocardial Revascularization ; methods ; Prospective Studies ; Retrospective Studies
9.Nude mice intraperitoneally transfused with ex vivo expanded bone marrow CD34+ CD59+ cells from patients with paroxysmal nocturnal hemoglobinuria.
Yu-Ping ZHONG ; Yong-Ji WU ; Ti SHEN ; Xuan WANG ; Jie-Ping ZHANG
Journal of Experimental Hematology 2006;14(1):75-78
Ex vivo expanded human bone marrow CD34(+)CD59(+) cells from patients with paroxysmal nocturnal hemoglobinuria (PNH) were transplanted into BALB/c mice in order to investigate their proliferation ability and reconstruction of hemopoiesis, and to lay the groundwork for clinical ABMT/APBSCT in PNH patients. CD34(+)CD59(+) cells were selected from the bone marrow mononuclear cells in PNH patients by using immunomagnetic positive double sorting. Sublethally irradiated BALB/c mice were transplanted with CD34(+)CD59(+) cells enriched from bone narrow of PNH patients. The results showed that human CD45(+) cells were detected in the bone marrow, spleen and peripheral blood of the nude mice by flow cytometry and DNA analysis at 6 weeks post-transplant. Blood routine indicators of nude mice were found to recover to some extent, but did not fully recover. It is concluded that ex vivo expanded bone marrow CD34(+)CD59(+) cells from patients with paroxysmal nocturnal hemoglobinuria could keep their biological characteristics and ability to reconstruct hemopoiesis in irradiated BALB/c mice.
Animals
;
Antigens, CD34
;
analysis
;
Bone Marrow Cells
;
cytology
;
immunology
;
CD59 Antigens
;
analysis
;
Female
;
Hematopoietic Stem Cell Transplantation
;
methods
;
Hemoglobinuria, Paroxysmal
;
pathology
;
therapy
;
Humans
;
Immunomagnetic Separation
;
Male
;
Mice
;
Mice, Inbred BALB C
;
Mice, Nude
;
Transplantation, Heterologous
10.Ex vivo expansion of CD34(+)CD59(+) cells from patients with paroxysmal nocturnal hemoglobinuria and their hematopoietic reconstitution capability in irradiated nude mice.
Yu-Ping ZHONG ; Yong-Ji WU ; Ti SHEN ; Xuan WANG ; Jie-Ping ZHANG
Journal of Experimental Hematology 2008;16(3):561-564
This study was purposed to investigate the expansion and hematopoietic reconstitution capability of CD34(+)CD59(+) cells from patients with paroxysmal nocturnal hemoglobinuria (PNH) by using BALB/c nude mice so as to provide experimental basis for clinical anto-BMT or auto-PBHSCT in patients with PNH. CD34(+)CD59(+) cells were selected from the bone marrow mononuclear cells in normal persons and PNH patients by immunomagnetic positive double sorting and were engrafted sublethally irradiated BALB/c nude mice. The human CD45(+) cells in bone marrow, spleen and peripheral blood of recipient mice were detected by flow cytometry and DNA assay. The results showed that the CD34(+)CD59(+) cells in PNH patient group and normal person group could expanded ex vivo, but ex vivo expansion capability of CD34(+)CD59(+) cells in PNH patient group at day 7 seemed inferior to that in normal control. While CD34(+)CD59(+) cells of PNH patients and normal persons were transfused into recipient mice, the human CD45(+) cells could be detected in bone marrow, spleen and peripheral blood at 6 weeks after transfusion, but there was no statistical difference in counts of CD45 cells between 2 groups. It is concluded that CD34(+)CD59(+) cells from PNH patients may keep characteristics of normal hematopoietic stem cells, and possess ability to expand ex vivo and support hemopoiesis.
Animals
;
Antigens, CD34
;
analysis
;
Bone Marrow Cells
;
cytology
;
immunology
;
CD59 Antigens
;
analysis
;
Female
;
Hematopoiesis
;
physiology
;
Hematopoietic Stem Cell Transplantation
;
Hemoglobinuria, Paroxysmal
;
pathology
;
Humans
;
Immunomagnetic Separation
;
Male
;
Mice
;
Mice, Inbred BALB C
;
Mice, Nude
;
Transplantation, Heterologous
;
Whole-Body Irradiation