Cervical artificial disc replacement (CADR) as a new method for the treatment of cervical spondylosis, is becoming a basic and clinical research. Compared with the anterior cervical discectomy and fusion (ACDF), the biggest difference of CADR lies in the reconstruction of the cervical vertebra height and physiological curvature, retaining the spinal physiological function maximally and reducing the degenerative changes in adjacent segments. A large number of clinical investigation have suggested that ACDR can become an operation method to replace the ACDF. However, the complications and the problems of prosthesis itself are gradually exposed, such as that the prosthesis, can't completely simulate the biological effects of human intervertebral disc, the other factors and including the operation methods and prosthesis itself. At the same time, the problem that how to prevent complications and problems is required to be solved. Whether, the effect of CADR on the activity of the operation segment, and the prevention of adjacent segment degeneration can be guaranteed for a long time has drawn more and more attention from scholars.
Cervical Vertebrae ; surgery ; Humans ; Postoperative Complications ; etiology ; Total Disc Replacement ; adverse effects

Objective To investigate expression of the phosphatase and tensin homolog (PTEN) gene in breast cancer cell line and its effect on biologic characteristics.Methods The normal PTEN expression cell line MDA-MB-231 (M231) was used in this study.PTEN-shRNA plasmid was transected into M231 breast cancer cells to knock down the expression of PTEN.The changes of PTEN expression,proliferation,invasion and metastasis of PTEN knocked down cell were tested by RT-PCR,Western blot,CCK-8,scratch and Transwell.Results PTEN-shRNA was successfully transected into M231 cells.PTEN mRNA and protein expression was efficiently inhibited in M231-3001 cell lines than that in control group M231-scr(P ＜ 0.01),M231-3001 cell lines showed a greater capability of colony formation,migration and invasion than that in control group M231-scr (all P ＜ 0.05).Conclusions PTEN,as a suppression gene,its low expression can promote the proliferation,migration and invasion of breast cancer cells.

Conjunctiva goblet cells are spread out within a stratified epithelium, and keep ocular surface homeostasis by secreting mucin.Previous research has shown conjunctiva goblet cells can secret mucin, remove debris and modulate ocular surface immune function.In this review, we will focus on biological characteristics of conjunctiva goblet cells and the effect of key factors SAM pointed domain Ets factor(SPDEF) on differentiation and function of conjunctiva goblet cells, and further understand relationship between goblet cells and eye health.

OBJECTIVE To discuss the preventive methods of hepatitis B virus reinfection after liver transplantation. METHODS Eighty eight liver transplantation recipients with HBV-related end-stage liver diseases including chronic fulminant hepatitis B,end-stage liver cirrhosis and liver carcinoma were analyzed retrospectively,and were given lamivudine pre-transplantation to prevent hepatitis B virus reinfection.Post-transplantation medicines of lamivudine were administered in 3 cases;lamivudine and hepatitis B immunoglobulin(HBIg) in 85 cases.The follow-up criteria included serum HBV,HBV-DNA,liver biopsy,immunohistochemical study of liver biopsy specimens and clinical manifestations.All of patients were followed-up 6 months at least.RESULTS Two of the three cases who taken lamivudine developed reinfection,the little time is 6 months following liver transplantation.There were three of eighty five cases taken lamicudine and HBIg(small dosage) developed reinfection.CONCLUSIONS Liver transplantation is an effective treatment for HBV-related end-stage liver diseases.Given lamivudine at the pre-transplantation could reduce the levels of the HBV virus copies.Lamivudine and HBIg post-transplantation offer effective prevention against hepatitis B virus reinfection.

The aim of the study is to evaluate the effects of the single and mixed decoction of Thallus laminariae (kelp) and Glycyrrhiza glabra (licorice) on the metabolism and their difference. The mixed decoction of kelp and licorice and the single decoction were made and intragastrically administered to the SD rats. The effect on system metabolism, the toxicity of liver and kidney were assessed by GC-MS profiling of the endogenous molecules in serum, routine biochemical assays and histographic inspection of tissues from SD rats, separately. The mixed decoction of kelp and licorice induced more obvious pathological abnormalities in SD rats than a single decoction of kelp, while the extracts of licorice did not show any pathological change. Neither the mixed, nor the single decoction showed abnormal histopathology. After intragastric administration of extracts for 5 days, the mixed decoction induced a decrease of ALT (no significant change in the groups of single decoction) and an increase of BUN (so did the single decoction of kelp). Metabolomic profile of the molecules in serum revealed that the metabolic patterns were all obviously affected for the three groups, i.e., the mixed and single decoction of kelp and licorice. The rats given with the single decoction of kelp showed a similar pattern to that of the mixed decoction, indicating that the kelp primarily contributed the perturbation of metabolism for the mixed decoction. All three groups induced a decrease of branched chain amino acids, TCA cycle intermediates and glycolysis intermediates (e.g., pyruvic acid and lactic acid) and an increase of 3-hydroxybutyric acid. Kelp decoction showed stronger potential in reducing TCA cycle intermediates and glycolysis intermediates than the other two groups, while the levels of branched chain amino acids were the lowest after licorice extracts were given. These results suggested that the effect of the mixed decoction on metabolism was closely associated with both kelp and licorice. The continuous administration of single decoction of kelp and the mixed decoction of licorice and kelp resulted in pathological abnormalities in kidney of SD rats. The mixed decoction of kelp and licorice distinctly perturbed sera molecules and hence system metabolism, which showed associated with those of kelp and licorice. Although the metabolic effect was associated with both kelp and licorice, the results suggested kelp contributed to it primarily.
Animals ; Glycyrrhiza ; chemistry ; Kelp ; chemistry ; Kidney ; drug effects ; Liver ; drug effects ; Metabolomics ; Plant Preparations ; pharmacology ; Rats ; Rats, Sprague-Dawley

Background: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATITA-GAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOV A)in R software.Results: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90％to 99.97％),followed by many other fungal groups(each ＜1.41％).ITS genotype was 4efined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P = 0.0014)between infectious group and control group was observed.Conclusions: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.

This study was purposed to analyse the immunophenotypic characteristics of chronic myelomonocytic leukemia (CMML), myelodysplastic syndromes (MDS) and acute monocytic leukemia (AML-M5b) by using multiparameter flow cytometry, and to explore its significance in diagnosis and differential diagnosis. The immunophenotypic characteristics of bone marrow samples from 14 CMML patients, 48 MDS patients, 46 AML-M5b patients and 18 normal persons were analyzed and compared by multiparametric flow cytometry. The results showed that the ratio of monocytes in CMML patients was obviously higher than that in MDS, AML-M5b patients and normal persons (P < 0.05), but there was no statistically significant difference between bone marrow samples of MDS and AML-M5b patients as well as normal persons. The ratio of blast cells in MDS patients was obviously higher than that in normal persons (P < 0.05), but did not show significant difference as compared with CMML patients. The ratio of mature granulocytes in AML-M5b patients was obviously lower than that in CMML and MDS patients as well as normal person bone marrow (P < 0.05). Certain differences of CD45/SSC characteristics in MDS, AML-M5b and CMML patients were found in comparison with normal persons. The abnormal expression of CD2, CD56, and CD14 tailing phenomenon were observed in CMML patients in comparison with bone marrow samples of MDS, AML-M5b and normal persons (P < 0.05). Lack and decrease of CD15 expression in MDS and CMML patients was significant different from AML-M5b and normal persons marrow, abnormal expression rate of CD15 in CMML patients was higher than that in MDS patients (P < 0.05), the CD13/CD11b/CD16 abnormal expression of granulocytes was seen in both CMML and MDS patients, but there was no statistically significant difference between them. Other antigens showed abnormality of varying degrees, but did not have any statistical significance. It is concluded that MDS, CMML and AML-M5b displayed a certain degree of similarity, and also possess their own immunophenotype characteristics. Comprehensive analysis of immunophenotype by multiparameter flow cytometry may be important for differential diagnosis among CMML, MDS and AML-M5b. High percentage of monocytes, abnormal coexpression of CD2, CD56 and CD14 tailing phenomenon, lack or decrease of CD15 as well as abnormal expression of CD13/CD11b/CD16 in granulocytes may play important roles in diagnosis of CMML.
Case-Control Studies ; Flow Cytometry ; methods ; Humans ; Immunophenotyping ; methods ; Leukemia, Monocytic, Acute ; diagnosis ; immunology ; Leukemia, Myelomonocytic, Chronic ; diagnosis ; immunology ; Myelodysplastic Syndromes ; diagnosis ; immunology

OBJECTIVETo investigate the level of occupational exposure to 5-fluorouracil (5-Fu) in the pharmacy intravenous admixture service (PIVAS) of a hospital, and identify the sources of 5-Fu contamination.

METHODSThe 5-Fu concentrations in air, on the surface of different areas in PIVAS and personal protective equipments were detected using UV-vis spectrophotometry.

RESULTSThe 5-Fu in air could not be detected. The 5-Fu concentrations on five different surfaces of biological safety cabinets were (22.00 +/- 6.35), (13.99 +/- 2.46), (14.13 +/- 0.72), (7.25 +/- 1.19) and (9.87 +/- 1.23) ng/cm2, respectively, which were significantly higher than those [(3.14 +/- 0.04), (5.43 +/- 0.65), (2.26 +/- 0.17), (2.26 +/- 0.17) and (3.63 +/- 0.46) ng/cm2] of corresponding controls (P < 0.05 or P < 0.01). The 5-Fu concentrations of the floor under cabinets [(18.19 +/- 5.22) ng/cm2], the floor in front of cabinets [(10.25 +/- 2.57)ng/cm2], the office floor [(11.64 +/- 2.53) ng/cm2], the terrace floor [(99.89 +/- 14.06 ) ng/cm2], the floor beside trash can in dressing room [(24.54 +/- 0.23) ng/cm2] were significantly higher than those of control [(3.36 +/- 0.11 ) ng/cm2] (P < 0.05 or P < 0.01). The 5-Fu concentrations of the tables in preparation room [(7.22 +/- l.04) ng/cm2] and the tables in office [(11.81 +/- 1.18) ng/cm2] were significantly higher than those of control [(5.56 +/- 0.14) ng/cm2] (P < 0.05 or P < 0.01). The 5-Fu concentrations of the indoor handle in preparation room were significantly higher than those of controls (P < 0.05 or P < 0.01). 5-Fu concentrations on the surfaces of outdoor handle and floor beside door in preparation room were not significantly increased compared with controls (P > 0.05). The 5-Fu concentrations on the surfaces of infusion bags, transfer box, transfer trays were significantly higher than those of controls (P < 0.05). The differences of 5-Fu concentrations between outer and inner masks and controls were not significant (P > 0.05). The 5-Fu concentrations of gloves of preparing and checking staffs were significantly higher than those of controls (P < 0.05 or P < 0.01).

CONCLUSIONThe preparing and checking process of 5-Fu and the treatment of medical wastes are major sources of 5-Fu contamination.

Ex vivo expanded human bone marrow CD34(+)CD59(+) cells from patients with paroxysmal nocturnal hemoglobinuria (PNH) were transplanted into BALB/c mice in order to investigate their proliferation ability and reconstruction of hemopoiesis, and to lay the groundwork for clinical ABMT/APBSCT in PNH patients. CD34(+)CD59(+) cells were selected from the bone marrow mononuclear cells in PNH patients by using immunomagnetic positive double sorting. Sublethally irradiated BALB/c mice were transplanted with CD34(+)CD59(+) cells enriched from bone narrow of PNH patients. The results showed that human CD45(+) cells were detected in the bone marrow, spleen and peripheral blood of the nude mice by flow cytometry and DNA analysis at 6 weeks post-transplant. Blood routine indicators of nude mice were found to recover to some extent, but did not fully recover. It is concluded that ex vivo expanded bone marrow CD34(+)CD59(+) cells from patients with paroxysmal nocturnal hemoglobinuria could keep their biological characteristics and ability to reconstruct hemopoiesis in irradiated BALB/c mice.
Animals ; Antigens, CD34 ; analysis ; Bone Marrow Cells ; cytology ; immunology ; CD59 Antigens ; analysis ; Female ; Hematopoietic Stem Cell Transplantation ; methods ; Hemoglobinuria, Paroxysmal ; pathology ; therapy ; Humans ; Immunomagnetic Separation ; Male ; Mice ; Mice, Inbred BALB C ; Mice, Nude ; Transplantation, Heterologous

This study was purposed to investigate the expansion and hematopoietic reconstitution capability of CD34(+)CD59(+) cells from patients with paroxysmal nocturnal hemoglobinuria (PNH) by using BALB/c nude mice so as to provide experimental basis for clinical anto-BMT or auto-PBHSCT in patients with PNH. CD34(+)CD59(+) cells were selected from the bone marrow mononuclear cells in normal persons and PNH patients by immunomagnetic positive double sorting and were engrafted sublethally irradiated BALB/c nude mice. The human CD45(+) cells in bone marrow, spleen and peripheral blood of recipient mice were detected by flow cytometry and DNA assay. The results showed that the CD34(+)CD59(+) cells in PNH patient group and normal person group could expanded ex vivo, but ex vivo expansion capability of CD34(+)CD59(+) cells in PNH patient group at day 7 seemed inferior to that in normal control. While CD34(+)CD59(+) cells of PNH patients and normal persons were transfused into recipient mice, the human CD45(+) cells could be detected in bone marrow, spleen and peripheral blood at 6 weeks after transfusion, but there was no statistical difference in counts of CD45 cells between 2 groups. It is concluded that CD34(+)CD59(+) cells from PNH patients may keep characteristics of normal hematopoietic stem cells, and possess ability to expand ex vivo and support hemopoiesis.
Animals ; Antigens, CD34 ; analysis ; Bone Marrow Cells ; cytology ; immunology ; CD59 Antigens ; analysis ; Female ; Hematopoiesis ; physiology ; Hematopoietic Stem Cell Transplantation ; Hemoglobinuria, Paroxysmal ; pathology ; Humans ; Immunomagnetic Separation ; Male ; Mice ; Mice, Inbred BALB C ; Mice, Nude ; Transplantation, Heterologous ; Whole-Body Irradiation