Cervical artificial disc replacement (CADR) as a new method for the treatment of cervical spondylosis, is becoming a basic and clinical research. Compared with the anterior cervical discectomy and fusion (ACDF), the biggest difference of CADR lies in the reconstruction of the cervical vertebra height and physiological curvature, retaining the spinal physiological function maximally and reducing the degenerative changes in adjacent segments. A large number of clinical investigation have suggested that ACDR can become an operation method to replace the ACDF. However, the complications and the problems of prosthesis itself are gradually exposed, such as that the prosthesis, can't completely simulate the biological effects of human intervertebral disc, the other factors and including the operation methods and prosthesis itself. At the same time, the problem that how to prevent complications and problems is required to be solved. Whether, the effect of CADR on the activity of the operation segment, and the prevention of adjacent segment degeneration can be guaranteed for a long time has drawn more and more attention from scholars.
Cervical Vertebrae ; surgery ; Humans ; Postoperative Complications ; etiology ; Total Disc Replacement ; adverse effects

Objective To investigate expression of the phosphatase and tensin homolog (PTEN) gene in breast cancer cell line and its effect on biologic characteristics.Methods The normal PTEN expression cell line MDA-MB-231 (M231) was used in this study.PTEN-shRNA plasmid was transected into M231 breast cancer cells to knock down the expression of PTEN.The changes of PTEN expression,proliferation,invasion and metastasis of PTEN knocked down cell were tested by RT-PCR,Western blot,CCK-8,scratch and Transwell.Results PTEN-shRNA was successfully transected into M231 cells.PTEN mRNA and protein expression was efficiently inhibited in M231-3001 cell lines than that in control group M231-scr(P ＜ 0.01),M231-3001 cell lines showed a greater capability of colony formation,migration and invasion than that in control group M231-scr (all P ＜ 0.05).Conclusions PTEN,as a suppression gene,its low expression can promote the proliferation,migration and invasion of breast cancer cells.

Conjunctiva goblet cells are spread out within a stratified epithelium, and keep ocular surface homeostasis by secreting mucin.Previous research has shown conjunctiva goblet cells can secret mucin, remove debris and modulate ocular surface immune function.In this review, we will focus on biological characteristics of conjunctiva goblet cells and the effect of key factors SAM pointed domain Ets factor(SPDEF) on differentiation and function of conjunctiva goblet cells, and further understand relationship between goblet cells and eye health.

OBJECTIVE To discuss the preventive methods of hepatitis B virus reinfection after liver transplantation. METHODS Eighty eight liver transplantation recipients with HBV-related end-stage liver diseases including chronic fulminant hepatitis B,end-stage liver cirrhosis and liver carcinoma were analyzed retrospectively,and were given lamivudine pre-transplantation to prevent hepatitis B virus reinfection.Post-transplantation medicines of lamivudine were administered in 3 cases;lamivudine and hepatitis B immunoglobulin(HBIg) in 85 cases.The follow-up criteria included serum HBV,HBV-DNA,liver biopsy,immunohistochemical study of liver biopsy specimens and clinical manifestations.All of patients were followed-up 6 months at least.RESULTS Two of the three cases who taken lamivudine developed reinfection,the little time is 6 months following liver transplantation.There were three of eighty five cases taken lamicudine and HBIg(small dosage) developed reinfection.CONCLUSIONS Liver transplantation is an effective treatment for HBV-related end-stage liver diseases.Given lamivudine at the pre-transplantation could reduce the levels of the HBV virus copies.Lamivudine and HBIg post-transplantation offer effective prevention against hepatitis B virus reinfection.

The aim of the study is to evaluate the effects of the single and mixed decoction of Thallus laminariae (kelp) and Glycyrrhiza glabra (licorice) on the metabolism and their difference. The mixed decoction of kelp and licorice and the single decoction were made and intragastrically administered to the SD rats. The effect on system metabolism, the toxicity of liver and kidney were assessed by GC-MS profiling of the endogenous molecules in serum, routine biochemical assays and histographic inspection of tissues from SD rats, separately. The mixed decoction of kelp and licorice induced more obvious pathological abnormalities in SD rats than a single decoction of kelp, while the extracts of licorice did not show any pathological change. Neither the mixed, nor the single decoction showed abnormal histopathology. After intragastric administration of extracts for 5 days, the mixed decoction induced a decrease of ALT (no significant change in the groups of single decoction) and an increase of BUN (so did the single decoction of kelp). Metabolomic profile of the molecules in serum revealed that the metabolic patterns were all obviously affected for the three groups, i.e., the mixed and single decoction of kelp and licorice. The rats given with the single decoction of kelp showed a similar pattern to that of the mixed decoction, indicating that the kelp primarily contributed the perturbation of metabolism for the mixed decoction. All three groups induced a decrease of branched chain amino acids, TCA cycle intermediates and glycolysis intermediates (e.g., pyruvic acid and lactic acid) and an increase of 3-hydroxybutyric acid. Kelp decoction showed stronger potential in reducing TCA cycle intermediates and glycolysis intermediates than the other two groups, while the levels of branched chain amino acids were the lowest after licorice extracts were given. These results suggested that the effect of the mixed decoction on metabolism was closely associated with both kelp and licorice. The continuous administration of single decoction of kelp and the mixed decoction of licorice and kelp resulted in pathological abnormalities in kidney of SD rats. The mixed decoction of kelp and licorice distinctly perturbed sera molecules and hence system metabolism, which showed associated with those of kelp and licorice. Although the metabolic effect was associated with both kelp and licorice, the results suggested kelp contributed to it primarily.
Animals ; Glycyrrhiza ; chemistry ; Kelp ; chemistry ; Kidney ; drug effects ; Liver ; drug effects ; Metabolomics ; Plant Preparations ; pharmacology ; Rats ; Rats, Sprague-Dawley

Background: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATITA-GAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOV A)in R software.Results: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90％to 99.97％),followed by many other fungal groups(each ＜1.41％).ITS genotype was 4efined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P = 0.0014)between infectious group and control group was observed.Conclusions: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.

Ligustrazine, one of the major effective components of the Chinese traditional medicinal herb Ligusticum Chuanxiong Hort, has been reported plenty of biological activities, such as protect cardiovascular and cerebrovascular, neuroprotection and anti-tumor, et al. Because of its remarkable effects, studies on structural modification of ligustrazine have attracted much attention. Ligustrazine synthetic derivatives reported in recent decades are mainly derived from four primary intermediates (TMP-COOH, TMP-OH, TMP-NH2, HO-TMP-OH). To explore the neuroprotection activitiy of ligustrazine intermediates, six ligustrazine intermediates (2, 5, 8, 11, 12, 13) were synthesized and their protective effects against CoCl2-induced neurotoxicity in differentiated PC12 cells were studied. The target compounds were prepared via different chemical methods, including oxidation, substitution, esterification and amidation without changing the structure nucleus of ligustrazine. Compared with TMP (EC50 = 56.03 micromol x L(-1)), four compounds (2, 5, 12 and 13) exhibited higher activity (EC50 < 50 micromol x L(-1)) respectively, of which, compound 2 displayed the highest protective effect against the damaged PC12 cells (EC50 = 32.86 micromol x L(-1)), but target compounds 8 and 11 appeared lower activity (EC50 > 70 micromol x L(-1)). By structure-activity relationships analysis, the introduction of carboxyl, amino to the side chain of ligustrazine and appropriately increase the proportion of ligustrazine may contribute to enhance its neuroprotective activity, which provides a reference for the design, synthesis and activity screening of relevant series of ligustrazine derivatives in the future.
Animals ; Cell Differentiation ; drug effects ; Chemistry Techniques, Synthetic ; Cobalt ; toxicity ; Drugs, Chinese Herbal ; chemistry ; Neuroprotective Agents ; chemical synthesis ; chemistry ; pharmacology ; Neurotoxins ; toxicity ; PC12 Cells ; Pyrazines ; chemical synthesis ; chemistry ; pharmacology ; Rats

Ex vivo expanded human bone marrow CD34(+)CD59(+) cells from patients with paroxysmal nocturnal hemoglobinuria (PNH) were transplanted into BALB/c mice in order to investigate their proliferation ability and reconstruction of hemopoiesis, and to lay the groundwork for clinical ABMT/APBSCT in PNH patients. CD34(+)CD59(+) cells were selected from the bone marrow mononuclear cells in PNH patients by using immunomagnetic positive double sorting. Sublethally irradiated BALB/c mice were transplanted with CD34(+)CD59(+) cells enriched from bone narrow of PNH patients. The results showed that human CD45(+) cells were detected in the bone marrow, spleen and peripheral blood of the nude mice by flow cytometry and DNA analysis at 6 weeks post-transplant. Blood routine indicators of nude mice were found to recover to some extent, but did not fully recover. It is concluded that ex vivo expanded bone marrow CD34(+)CD59(+) cells from patients with paroxysmal nocturnal hemoglobinuria could keep their biological characteristics and ability to reconstruct hemopoiesis in irradiated BALB/c mice.
Animals ; Antigens, CD34 ; analysis ; Bone Marrow Cells ; cytology ; immunology ; CD59 Antigens ; analysis ; Female ; Hematopoietic Stem Cell Transplantation ; methods ; Hemoglobinuria, Paroxysmal ; pathology ; therapy ; Humans ; Immunomagnetic Separation ; Male ; Mice ; Mice, Inbred BALB C ; Mice, Nude ; Transplantation, Heterologous

Objective To optimize plan for right lobe living donor hepatectomy based on the territorial volume drained by the middle hepatic vein (MHV) as shown by preoperative MR image in donors.Methods Utilizing preoperative MR dynamic enhancement scanning image,virtually plot three types of hepatic parenchyma transsection plane based on the variation of including MHV for right lobe graft procurement. Results From June 2006 to May 2010,65 adult-to-adult right lobe living donor liver transplantations was performed at General Hospital of Chinese PLA,in which there were 43 grafts including MHV (66.2％,43/65 ), eight grafts including partial MHV which was dissected before the V4b abouchement ( 12.3％,8/65) and 14 grafts not including MHV (21.5％,14/65). There was no postoperative death in donors and the postoperative complications developed in 10.76％ (7/65). The recipients' perioperative mortality was 7.69％ (5/65). Ttwenty-one complications developed in 18 recipients,and the morbidity was 32.31％. The cumulative survival rates were 86％,77％ and 68％respectively for 1,2 and 3 years. Conclusions The optimizing liver resection plane could be practically designed preoperatively for right lobe graft procurement based on the territorial volume drained by MHV.

OBJECTIVETo approach the long term safety and efficacy of transmyocardial laser revascularization (TMLR, holmium: YAG) combined with off-pump coronary artery bypass (OPCAB) compared with OPCAB alone in patients with ischemic cardiac disease.

METHODSBetween 1999 and 2005, 80 patients with diffusely diseased target vessels from two centers in Beijing were enrolled to the study and randomized to receive either TMLR/OPCAB (n = 40) or OPCAB (n = 40) operation. Baseline demographics and operative characteristics were similar between groups. Follow-up (mean 3.4 +/- 1.7 years) included CCS angina class and NYHA classification assessments, 6 minutes walking test (6MWT) and echocardiography.

RESULTSPerioperative mortality was 5% in both groups. No death occurred during follow up. At the end of follow-up, patients at both groups experienced significant improvement on angina score compared with baseline, and angina score was also significantly lower (1.21 +/- 0.42 vs. 1.57 +/- 0.87, P = 0.03) and 6MWT-distance significantly increased (518.0 +/- 65.5 m vs. 473.8 +/- 65.8m, P = 0.006) in OPCAB/TMLR group than that in the OPCAB group. Fewer patients developed recurrent severe angina and received re-CABG/PCI in OPCAB/TMLR group than that in the OPCAB (1 vs. 6 cases, P = 0.113). NYHA and LVEF were similar between the groups at the end of follow up.

CONCLUSIONOur study showed that the addition of TMLR to OPCAB is superior in improving angina and exercise tolerance, but there is no further improvement in cardiac function compared to OPCAB alone.

Aged ; Angioplasty, Laser ; Combined Modality Therapy ; Coronary Artery Bypass, Off-Pump ; Coronary Disease ; therapy ; Female ; Follow-Up Studies ; Humans ; Male ; Middle Aged ; Myocardial Revascularization ; methods ; Prospective Studies ; Retrospective Studies