Objective To analyze the correlative factors of peptic ulcer recurrence in the elderly. Methods From January to December 2009,169 elderly patients (≥ 60 years old)with peptic ulcer delected by edoscopy were enrolled,whose treatment and usage of medication were analyzed.Data of treatment and recurrence in 3-year follow-up were recorded.Mann-Whitney rank sum test and Logistic regression analysis were performed to analyze the correlated factors.Results The potential risk factors associated with recurrence of peptic ulcer in the elderly were screened and analyzed by single factor analysis,and ulcer size, ulcer location, concomitant usage of drugs, smoking and condition of Helicobacterpylori (H .pylori )infection at the end of follow-up were found to be correlated with recurrence of peptic ulcer in the elderly.After adjusting age and gender,the potential risk factors were analyzed by a Logistic stepwise regression model.Smoking (OR = 1 .788,P = 0.001 ),combined medication (OR=6.202,P =0.015 ),ulcer size (OR =2.697,P =0.032 )and condition of H .pylori infection at the end of follow-up (OR=43.784,P =0.007)were found to be correlated with recurrence of peptic ulcer in the elderly.Conclusion Smoking,combined medication,ulcer size and condition of H .pylori infection at the end of follow-up have an impact on peptic ulcer recurrence in the elderly.

ObjectiveTo study how to diagnose thrombosis of intracranial venous sinus and cerebral venous thrombosis(CVT). Methods6 cases with intracranial venous sinus and CVT were analysed by clinical features and imaging signs. ResultsMost patients had symptoms and signs of intracranial hypertension. Some patients manifested symptoms of whole brain or focal neurological deficits. Magnetic resonance imaging (MRI) and magnetic resonance venography (MRV) play important roles for the diagnosis of intracranial venous sinus and CVT, however, digital subtraction angiography (DSA) is one of the most reliable method for early diagnosis of the above diseases.Conclusions According to clinical features and imaging signs, intracranial venous sinus and CVT could be diagnosed accurately .

This study investigated the protective effect of chrysin on hepatic fibrosis by regulating AMP-activated kinase (AMPK)-NOD-like receptor protein 3 (NLRP3) mediated pyroptosis pathway. The hepatic fibrosis model of mice was established by thioacetamide (TAA) in vivo. Except the control and chrysin alone groups, the mice were injected intraperitoneally with TAA at 100 mg·kg^-1, three times per week for the first week. From the 2^nd to 5^th week, mice were injected intraperitoneally with TAA at 200 mg·kg^-1, three times per week for the next 4 weeks. Chrysin groups were intragastrically administrated once per day to 5^th week. The histopathological changes were detected by HE and Masson staining. The levels of serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were assessed by the kits. All animal experiments were approved by the Medical Ethics Committee of Affiliated Zhongshan Hospital of Dalian University (DWLL2019060). LX-2 cells were stimulated by (transforming growth factor-β, TGF-β) in vitro. The protein expressions of AMPKα, p-AMPKα, NLRP3, cysteinyl aspartate specific proteinase-1 (caspase-1), gasdermin D (GSDMD) were detected by Western blot, and the mRNA levels of collagen-Ι, α-smooth muscle actin (α-SMA), interleukin-1β (IL-1β), IL-18, caspase-1, GSDMD were analysis by reverse transcription-polymerase chain reaction (RT-PCR). Chrysin attenuated the increases in serum AST and ALT levels in the TAA group, while significantly improved the changes of liver morphology, reduced liver tissue inflammatory cell infiltration and inhibited collagens deposition. Compared with TAA group, chrysin effectively activated AMPKα phosphorylation and inhibited hepatic NLRP3 inflammasome activation. Additionally, the protein expressions and mRNA levels of IL-1β, IL-18, caspase-1 and GSDMD in chrysin groups were decreased. Chrysin inhibited the expressions of collagen-Ι and α-SMA, enhanced the phosphorylation of AMPKα, and decreased the expressions of NLRP3 and GSDMD. Therefore, chrysin may inhibit inflammatory injury and pyroptosis possibly by activating AMPK and inhibiting NLRP3 inflammasome to alleviate hepatic fibrosis.

Objective To investigate the effects on proliferation of multiple myeloma cell lines U266 and RPMI 8226 induced by puerariae radix flavones (PRF) in vitro and its possible mechanism.Methods Exposed to 0,10,30,50,100 μg/ml PRF for 48 h and 72 h,the U266 and RPMI 8226 cells proliferation inhibitory rates were detected by MTT assay,cell cycles by flow cytometry (FCM),morphologic changes of U266 cells by Wright' s staining,and early-stage apoptotic rates of U266 cells by FITC-Annexin V/PI staining with FCM.Analysis of DNA fragment was made to test characteristic apoptosis DNA ladder in U266 cells.Results 0,10,30,50,100 μg/ml PRF could inhibit the proliferation of U266 and RPMI 8226 cells in a dose-dependent manner (U266 ＞ RPMI 8226).Cell cycle analyses in U266 and RPMI 8226 cells showed that sub-diploid peaks,but cell cycles changed minor.Wright's staining of U266 cells showed hardly any apoptostic character istic.Annexin V/PI double staining indicated that early-stage apoptotic rates of U266 cells exposed to 0,10,30,50,100 μg/ml PRF for 48 h were mildly increased in a dose-dependent manner.They were (3.20±0.36) ％,(5.20±0.92) ％,(7.30±1.22) ％,(8.10±0.53) ％ and (10.80±0.90) ％,respectively.The group differences had statistical significance (P ＜ 0.05).Analysis of DNA fragment barely exhibited the characteristic DNA ladder in U266 cells.Conclusion A certain concentrations of PRF could inhibit the proliferation of U266 and RPMI 8226 cells significantly.It is suggested that apoptosis related to the proliferative inhibition mechanism induced by PRF in U266 cell line,but not main.Other pathways such as necrosis and autophagy whether or not involved need further investigation.

Background: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATITA-GAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOV A)in R software.Results: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90％to 99.97％),followed by many other fungal groups(each ＜1.41％).ITS genotype was 4efined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P = 0.0014)between infectious group and control group was observed.Conclusions: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.

Background: There have been few reports of mutations in the beta-myosin heavy chain(MYH7)gene in hypertrophic cardiomyopathy(HCM),which is associated with sudden cardiac death caused by HCM.This study aimed to screen the mutation sites in the sarcomeric gene MYH7 in Chinese patients with HCM.We also p1anned to analyze the pathogenicity of the mutation site as well as its significance in clinical and forensic medicine.Methods: From January 2006 to June 2017,autopsy cases were collected from the Department of Pathology,the Affiliated Hospital of Qingdao University.The experiment was to detect MYH7 gene status in formalin-fixed paraffin-embedded tissues from 18 independent autopsy cases who suffered HCM related sudden death(fatal HCM)and 20 cases without cardiomyopathy.Common mutation exon fragments of MYH7 gene were amplified by polymerase chain reaction.The end-of-deoxygenation method and gene cloning method were further performed to analyze the mutation sites.Homologous comparison among mutant sites was conducted using BLAST online database.Results:The 1336th nucleotide of MYH7 gene at exon 14 was converted from T to G in one HCM case,resulting in the conversion of threonine(Thr)at position 446 to proline(Pro).In another case,the 1402th nucleotide at exon 14 was converted from T to C,resulting in the conversion of phenylalanine(Phe)at position 468 to leucine(Leu).Homologous comparison results showed that the two amino acid residues of Thr446 and Phe468 are highly conserved among different species.Conclusions: Our results showed fatal HCM harbored mutations of Thr446Pro and Phe468Leu in the MYH7 gene.It is significant for clinical and forensic medicine to further explore the functions and detailed mechanisms of these mutations.

OBJECTIVETo study the characteristics histologic and cytologic features and clinical usefulness of plasma cell myeloma (PCM) subtyping according to WHO PCM classification.

METHODSBone marrow biopsy plastic-embedded sections were stained with H-G-E and Gomori's stains, and bone marrow aspirate smears were stained with Wright's stain. The clinicopathologic findings were then analyzed.

RESULTSOf the 131 cases with PCM, three types of growth patterns were noted: interstitial (21 cases, 16.0%), nodular (46 cases, 35.1%) and packed (64 cases, 48.9%). Besides, there were three cytologic subtypes: mature plasma cell type (43 cases, 32.8%), immature (81 cases, 61.8%) and pleomorphic (7 cases, 5.3%) types. The age of patients with mature plasma cell type was significantly higher than that of immature type (P = 0.005); and the number of tumour cells in bone marrow smears was significantly higher than that of immature type (P = 0.003). The numbers of WBC and platelets in peripheral blood were also significantly higher than that of pleomorphic type (P = 0.024, P = 0.002, respectively). On the other hand, the number of platelets in peripheral blood of immature type was significantly higher than that of pleomorphic type (P = 0.019). Marrow fibrosis was more frequently observed in immature type than in mature plasma cell type (P = 0.000). The incidence of marrow fibrosis and osteolytic lesions was higher in high risk group than in low risk group (P = 0.000, P = 0.023 respectively). Twenty-one cases (56.8%) of the 37 cases treated with MP or MP and M2 chemotherapeutic regimens showed good response. However, there was no significant difference in treatment response and survival between different subtypes.

CONCLUSIONSEach subtype of PCM carries different clinicopathologic features in some aspects. The classification carries important value in pathologic diagnosis and probably in predicting prognosis.

Adult ; Aged ; Aged, 80 and over ; Biopsy ; Bone Marrow Examination ; Female ; Humans ; Immunophenotyping ; Male ; Middle Aged ; Multiple Myeloma ; classification ; immunology ; pathology ; Prognosis

To investigate the crucial role of particle size in the biological effects of nanoparticles, a series of mesoporous silica nanoparticles (MSNs) were prepared with particle size gradients (50, 100, 150, 200 nm) with the traditional Stober method and adjusting the type and ratio of the silica source. The correlation between toxicity and size-caused biological effects were then further examined both in vitro and in vivo. The results indicated that the prepared MSNs had a uniform size, good dispersal, and ordered mesoporous structure. Hemolytic toxicity was found to be independent of particle size. At the cellular level, MSNs with smaller particle sizes were more readily internalized by cells, which initiated to more intense oxidative stress, therefor inducing higher cytotoxicity, and apoptosis rate. In vivo studies demonstrated that MSNs primarily accumulated in the liver and kidneys of mice. Pharmacokinetic analysis revealed that larger MSNs were eliminated more efficiently by the urinary system than smaller MSNs. The mice's body weight monitoring, blood tests, and pathological sections of major organs indicated good biocompatibility for MSNs of different sizes. Animal welfare and the animal experimental protocols were strictly consistent with related ethics regulations of Zhejiang Chinese Medical University. Overall, this study prepared MSNs with a particle size gradient to investigate the correlation between toxicity and particle size using macrophages and endothelial cells. The study also examined the biosafety of MSNs with different particle sizes in vivo and in vitro, which could help to improve the safety design strategy of MSNs for drug delivery systems.

OBJECTIVETo manufacture the individual polyurethane (PUR) auricular framework using the rapid prototyping (RP) technique and to evaluate its feasibility in ear reconstruction.

METHODS3-D models of the patient's auricle were reconstructed according to the computed tomography (CT) data. The supporting and drainage structures were created. Then the individual PUR auricular frameworks were manufactured using RP technique. The frameworks were tested for the fatigue strength and elasticity. The frameworks were also put at the subcutaneous layer of rat. At 1, 2, 4, 8, 12 weeks after operation, the shape of the reconstructed ears was observed and the histological examination was performed.

RESULTSThe PUR framework had good elasticity and a much better fatigue strength than high density polyethylene (HDPE) framework. The shape of reconstructed ear matched the prototype very well. The around tissue grew into the implant pore and adhered tightly to the framework 2 weeks after implantation. Histologic examination showed integrated capsule four weeks later without lymphocytes infiltration. The shape kept very well twelve weeks later.

CONCLUSIONSPUR auricular framework manufactured by the 3D reconstruction and RP techniques has very good shape, intensity and elasticity. It can be selected to replace the autograft of rib cartilage framework.

Animals ; Computer-Aided Design ; Ear, External ; surgery ; Humans ; Otologic Surgical Procedures ; instrumentation ; Prosthesis Design ; Rats ; Rats, Wistar ; Reconstructive Surgical Procedures ; instrumentation ; Stents