1. RP-HPLC method for the simultaneous determination of daidzein, genistein and formonetin in Solanum Lyratum thunb
Academic Journal of Xi'an Jiaotong University 2010;22(3):156-159
A rapid method for the simultaneous determination of daidzein, genistein and formonetin in Solanum Lyratum Thunb by high performance liquid chromatography (HPLC) was developed. Separation was achieved on a Diamonsil C18 column (250 mm X 4.6 mm, 5 μm) with isocratic elution, using a mobile phase of methanol-tetrahydrofuran-water (44:3:53, v/v). The wavelength was set at 260 nm and column was maintained at 35°C. The linear ranges of daidzein, genistein and formonetin were 1.0-40.0, 0.1-4.0 and 0.1-4.0 μg/mL, respectively. The average recoveries were between 98.4% and 101.3 %. This method could be used for the quality control of Solanum lyratum Thunb due to its simplification, reliability, rapidity and excellent precision.
2. RP-HPLC method for the simultaneous determination of daidzein, genistein and formonetin in Solanum Lyratum thunb
Academic Journal of Xi'an Jiaotong University 2010;22(3):156-159
A rapid method for the simultaneous determination of daidzein, genistein and formonetin in Solanum Lyratum Thunb by high performance liquid chromatography (HPLC) was developed. Separation was achieved on a Diamonsil C18 column (250 mm X 4.6 mm, 5 μm) with isocratic elution, using a mobile phase of methanol-tetrahydrofuran-water (44:3:53, v/v). The wavelength was set at 260 nm and column was maintained at 35°C. The linear ranges of daidzein, genistein and formonetin were 1.0-40.0, 0.1-4.0 and 0.1-4.0 μg/mL, respectively. The average recoveries were between 98.4% and 101.3 %. This method could be used for the quality control of Solanum lyratum Thunb due to its simplification, reliability, rapidity and excellent precision.
4.Clinical study of dexmedetomidine combined with parecoxib sodium in preventing post-anesthetic hyperal-gesia induced by remifentanil
Yu WANG ; Rong JIANG ; Jia DENG ; Wenjie SU ; Guangmin XU
The Journal of Clinical Anesthesiology 2014;(12):1152-1155
Objective To observe the preventive efficacy and safety of dexmedetomidine with parecoxib sodium on the patients with postoperative hyperalgesia induced by remifentanil. Methods A total of 100 female patients undergoing elective surgery under general anesthesia were as-signed into four groups according to the table of random number:the control group (group C),the parecoxib sodium group (group P),the dexmedetomidine group (group D)and the parecoxib sodium combined with the dexmedetomidine group (group DP).The vital signs were monitored and the total intravenous anesthesia was performed.All the patients were give intravenous injection of 0.2μg·kg-1 ·min-1 remifentanil and 4-12 mg·kg-1 ·h-1 propofol to maintain the anesthesia.Patients in group P were given 40 mg parecoxib sodium 30 minutes before the end of the operation.Patients in group D were give intravenous injection of 0.6μg·kg-1 ·min-1 dexmedetomidine consistently till 30 min before the end of the operation.Patients in group DP were given 0.6 μg·kg-1 ·min-1 till 30 min before the end of the operation and were given 40 mg parecoxib sodium.The VAS scores were re-corded at 1,2,6,12,24 hours.The cases of agitation,rigors,nausea and vomiting and increasing of analgesics were recorded.Results The postoperative VAS scores in group P,group D and group DP were significantly lower than group C(P <0.05).The postoperative VAS scores in group DP were significantly lower in group P and group D (P<0.05).Cases of agitation and rigors in group D and group DP were less than group C(P <0.05).The increasing of analgesics in group DP was much higher than other groups(P<0.05).Conclusion After induced,patients were given intravenous in-jection of 0.6 μg·kg-1 ·min-1 dexmedetoniding consistently till 30 min before the end of the opera-tion were given 40 mg parecoxib sodium can effectively prevent hyperalgesia after remifentanil anes-thesia without significant increase in revival time and obtain a better sedation.
5.Characteristics and strategies of novelty assessment of literature on information technology
Wei WANG ; Wenhui RONG ; Na LI ; Xiangchun JIA ; Yu ZHANG
Chinese Journal of Medical Library and Information Science 2013;(12):67-69
After a description of the characteristics of novelty assessment of literature on information technology involving different subjects, multiple new technologies and deep knowledge, the strategies were elaborated for it.
6.Influence of hypoxia preconditioning on hypoxia-inducible factor- 1alpha in hypoxic-ischemic brain damage in the neonatal rat.
Xiang-rong ZHENG ; Yu-jia YANG ; Yan-jie JIA ; Jie-po LIU
Chinese Journal of Pediatrics 2003;41(12):946-947
Animals
;
Animals, Newborn
;
Brain
;
metabolism
;
pathology
;
Caspase 3
;
Caspases
;
metabolism
;
DNA-Binding Proteins
;
genetics
;
Gene Expression
;
Hypoxia, Brain
;
genetics
;
physiopathology
;
Hypoxia-Inducible Factor 1
;
Hypoxia-Inducible Factor 1, alpha Subunit
;
Immunohistochemistry
;
Ischemic Preconditioning
;
Nuclear Proteins
;
genetics
;
RNA
;
genetics
;
metabolism
;
Random Allocation
;
Rats
;
Rats, Sprague-Dawley
;
Reverse Transcriptase Polymerase Chain Reaction
;
Transcription Factors
8.Vascular-specific promoters and cis-regulatory elements.
Chinese Journal of Biotechnology 2003;19(2):131-135
Vascular-resided bacterial and fungal diseases have caused a great deal of yield loss and quality reduction in crop production world-wide. For genetic engineering of crops resistant to these diseases, it is disirable to have a strong and vascular-specific promoter. This article reviews the progress in identification of vascular-specific promoters and its function. To date, roughly twenty vascular-specific promoters have been documented. The cis-elements and motifs have been studied in detail for the promoters of bean phenylalanine ammonia lyase (PAL2), bean glycine-rich protein (grp 1.8) and Arabidopsis profilin2 (pfn2) in particular.The motif of vs-1 (CATGCTCCGTTGGATGTGGAAGACAGCA) found in grp 1.8 promoter was a cis-element that specificically bind to a transcription activation factor VSF-1 protein (one of the bZIP proteins). Mutation of vs-1 prevented it from binding to VSF-1 that resulted in abolishing the vascular-specific expresson of gus gene. Motifs of AC-I and AC-II found in PAL2 promoter were also found to be essential for vascular-specific expression. In our laboratory we have dissected pfn2 promoter into three domains (A, B, C) through 5'-deletion analysis. In this promoter we have identified two core sequences of ACGT that is commonly found in the binding sites of bZIP protein, the most abundent transcription factor existed in plants. In additon, the pfn2 promoter also contains an AC- I like sequence (CCACCTAC) that is similar to the AC- I motif (CCCACCTACC) found in PAL2 promoter. These promoters and cis-elements may have a wide range of potential applications to the genetic improvement of crops resistant to vascular diseases.
Gene Expression Regulation, Plant
;
genetics
;
physiology
;
Phenylalanine Ammonia-Lyase
;
genetics
;
Plant Proteins
;
genetics
;
Promoter Regions, Genetic
;
genetics
;
Regulatory Sequences, Nucleic Acid
;
genetics
9.Association of red blood cell damage with arachidonic acid.
Tao YUAN ; Jian-ning ZHAO ; Jia MENG ; Yu CONG ; Shuang-shuang CHEN ; Ni-rong BAO
China Journal of Orthopaedics and Traumatology 2016;29(2):179-183
OBJECTIVETo study the correlation between arachidonic acid (AA) and acute red blood cells damage in rats, and to build a model with hidden blood loss in vivo, and to explore the pathological mechenism of hidden blood loss.
METHODSA total of 50 male adult Sprague-Dawley rats weighing (200 ± 20) g were randomly divided into five groups (n = 10): control group and four experimental groups. The rats in the experimental groups were given 0.5 ml different concentrations of AA dilu- ents, 5, 10, 20, 40 mmol/L respectively. The blood samples were collected from orbital venous at the beginning and 24, 48, 72 hours after administration. Then the changes of hemoglobin (Hb) ,red blood cell count (RBC), glutathione peroxidase (GSH- PX) activity, total superoxide dismutase (T-SOD) activity and hydrogen peroxide (H202) in the blood samples were tested.
RESULTSSignificant hidden blood loss occurred when the concentration was 10 mmol/L in the experimental group, with the RBC and Hb sharply reduced in blood samples. The Hb and RBC were reduced in all the experimental groups and control group at 24 hours after administration, while in the experimental groups they changed more obviously. The GSH-PX activity, T-SOD activity and H₂O₂were also significantly reduced in all groups, and the changes showed significant differences. The Hb and RBC were relatively stable in the control group and the experimental groups at 48 hours after administration; while GSH-PX activity, T-SOD activity and H₂O₂were all significantly decreased, and the changes in the experimental groups were more notable.
CONCLUSIONElevated levels of AA in the blood causes oxidative stress in the red blood cells, leading to the damage of red blood cells and hemoglobin, which is responsible for hidden blood loss.
Animals ; Arachidonic Acid ; toxicity ; Erythrocytes ; drug effects ; metabolism ; Glutathione Peroxidase ; blood ; Hemoglobins ; analysis ; Male ; Rats ; Rats, Sprague-Dawley ; Superoxide Dismutase ; blood
10.Clinical Analysis on 51 Cases of Children with Demyelinating Disease
jun, XU ; rong, HUANG ; yu-jia, YANG ; min, XIE ; jin-feng, ZHANG
Journal of Applied Clinical Pediatrics 2004;0(12):-
Objective To study the clinical characteristics of children with demyelinating disease.Methods Age of onset,presymptoms,clinical manifestations and auxiliary examinations of 51 children diagnosed as demyelinating disease were analyzed retrospectively.Results The onset age was from 3 months to 14 years,and the number of school age children was 38.Before illness,32 cases were relevant to infection,3 cases to vaccine inoculation.Most of children had acute courses.In the initial stage,32 cases with peripheral nervous demyelinating disease presented to paralysis of limbs;18 cases with central nervous demyelinating disease presented to visual disorder,somatasthenia,fever,convulsion and headache.The EMGs of children with peripheral nervous demyelinating disease showed nervous lesion.Among 18 children with central nervous demyelinating disease,17 cases showed abnomal signal on MRI or CT.Conclusions Children with demyelinating disease displays diversified clinical manifestations.By investigating case history combined with auxiliary exaninations,it is not difficult to make a correct diagnosis and its prognosis is good commonly.