A rapid method for the simultaneous determination of daidzein, genistein and formonetin in Solanum Lyratum Thunb by high performance liquid chromatography (HPLC) was developed. Separation was achieved on a Diamonsil C18 column (250 mm X 4.6 mm, 5 μm) with isocratic elution, using a mobile phase of methanol-tetrahydrofuran-water (44:3:53, v/v). The wavelength was set at 260 nm and column was maintained at 35°C. The linear ranges of daidzein, genistein and formonetin were 1.0-40.0, 0.1-4.0 and 0.1-4.0 μg/mL, respectively. The average recoveries were between 98.4% and 101.3 %. This method could be used for the quality control of Solanum lyratum Thunb due to its simplification, reliability, rapidity and excellent precision.

A rapid method for the simultaneous determination of daidzein, genistein and formonetin in Solanum Lyratum Thunb by high performance liquid chromatography (HPLC) was developed. Separation was achieved on a Diamonsil C18 column (250 mm X 4.6 mm, 5 μm) with isocratic elution, using a mobile phase of methanol-tetrahydrofuran-water (44:3:53, v/v). The wavelength was set at 260 nm and column was maintained at 35°C. The linear ranges of daidzein, genistein and formonetin were 1.0-40.0, 0.1-4.0 and 0.1-4.0 μg/mL, respectively. The average recoveries were between 98.4% and 101.3 %. This method could be used for the quality control of Solanum lyratum Thunb due to its simplification, reliability, rapidity and excellent precision.

Animals ; Apoptosis ; Hypoxia-Inducible Factor 1, alpha Subunit ; Hypoxia-Ischemia, Brain ; genetics ; pathology ; Neurons ; cytology ; metabolism ; RNA, Messenger ; analysis ; Rats ; Rats, Sprague-Dawley ; Transcription Factors ; genetics

After a description of the characteristics of novelty assessment of literature on information technology involving different subjects, multiple new technologies and deep knowledge, the strategies were elaborated for it.

Objective To observe the preventive efficacy and safety of dexmedetomidine with parecoxib sodium on the patients with postoperative hyperalgesia induced by remifentanil. Methods A total of 100 female patients undergoing elective surgery under general anesthesia were as-signed into four groups according to the table of random number:the control group (group C),the parecoxib sodium group (group P),the dexmedetomidine group (group D)and the parecoxib sodium combined with the dexmedetomidine group (group DP).The vital signs were monitored and the total intravenous anesthesia was performed.All the patients were give intravenous injection of 0.2μg·kg-1 ·min-1 remifentanil and 4-12 mg·kg-1 ·h-1 propofol to maintain the anesthesia.Patients in group P were given 40 mg parecoxib sodium 30 minutes before the end of the operation.Patients in group D were give intravenous injection of 0.6μg·kg-1 ·min-1 dexmedetomidine consistently till 30 min before the end of the operation.Patients in group DP were given 0.6 μg·kg-1 ·min-1 till 30 min before the end of the operation and were given 40 mg parecoxib sodium.The VAS scores were re-corded at 1,2,6,12,24 hours.The cases of agitation,rigors,nausea and vomiting and increasing of analgesics were recorded.Results The postoperative VAS scores in group P,group D and group DP were significantly lower than group C(P <0.05).The postoperative VAS scores in group DP were significantly lower in group P and group D (P<0.05).Cases of agitation and rigors in group D and group DP were less than group C(P <0.05).The increasing of analgesics in group DP was much higher than other groups(P<0.05).Conclusion After induced,patients were given intravenous in-jection of 0.6 μg·kg-1 ·min-1 dexmedetoniding consistently till 30 min before the end of the opera-tion were given 40 mg parecoxib sodium can effectively prevent hyperalgesia after remifentanil anes-thesia without significant increase in revival time and obtain a better sedation.

Animals ; Animals, Newborn ; Brain ; metabolism ; pathology ; Caspase 3 ; Caspases ; metabolism ; DNA-Binding Proteins ; genetics ; Gene Expression ; Hypoxia, Brain ; genetics ; physiopathology ; Hypoxia-Inducible Factor 1 ; Hypoxia-Inducible Factor 1, alpha Subunit ; Immunohistochemistry ; Ischemic Preconditioning ; Nuclear Proteins ; genetics ; RNA ; genetics ; metabolism ; Random Allocation ; Rats ; Rats, Sprague-Dawley ; Reverse Transcriptase Polymerase Chain Reaction ; Transcription Factors

Vascular-resided bacterial and fungal diseases have caused a great deal of yield loss and quality reduction in crop production world-wide. For genetic engineering of crops resistant to these diseases, it is disirable to have a strong and vascular-specific promoter. This article reviews the progress in identification of vascular-specific promoters and its function. To date, roughly twenty vascular-specific promoters have been documented. The cis-elements and motifs have been studied in detail for the promoters of bean phenylalanine ammonia lyase (PAL2), bean glycine-rich protein (grp 1.8) and Arabidopsis profilin2 (pfn2) in particular.The motif of vs-1 (CATGCTCCGTTGGATGTGGAAGACAGCA) found in grp 1.8 promoter was a cis-element that specificically bind to a transcription activation factor VSF-1 protein (one of the bZIP proteins). Mutation of vs-1 prevented it from binding to VSF-1 that resulted in abolishing the vascular-specific expresson of gus gene. Motifs of AC-I and AC-II found in PAL2 promoter were also found to be essential for vascular-specific expression. In our laboratory we have dissected pfn2 promoter into three domains (A, B, C) through 5'-deletion analysis. In this promoter we have identified two core sequences of ACGT that is commonly found in the binding sites of bZIP protein, the most abundent transcription factor existed in plants. In additon, the pfn2 promoter also contains an AC- I like sequence (CCACCTAC) that is similar to the AC- I motif (CCCACCTACC) found in PAL2 promoter. These promoters and cis-elements may have a wide range of potential applications to the genetic improvement of crops resistant to vascular diseases.
Gene Expression Regulation, Plant ; genetics ; physiology ; Phenylalanine Ammonia-Lyase ; genetics ; Plant Proteins ; genetics ; Promoter Regions, Genetic ; genetics ; Regulatory Sequences, Nucleic Acid ; genetics

Child ; Child, Preschool ; Female ; Humans ; Infant ; Infant, Newborn ; Intracranial Hemorrhages ; etiology ; pathology ; Magnetic Resonance Imaging ; Prognosis ; Tomography, X-Ray Computed

ObjectiveTo compare clinical and laboratory outcomes of in vitro maturation (IVM) with in vitro fertilization-embryo transfer (IVF-ET) in treatment of infertility associated with polycystic ovary syndrome (PCOS).MethodsFrom Jan.2007 to Dec.2010,infertile patients with PCOS underwent 701 cycles in First Affiliated Hospital of Wenzhou Medical College were studied retrospectively.Those were divided into 293 cycles of IVM group and 408 cycles of IVF/intra-cytoplasmic sperm injection ( ICSI ) group.The average transplantation rate,mean number of retrieval oocytes,maturation rate,fertilization rate,cleavage rate,high quality embryo rate,embryo implantation rate,pregnancy rate per transfer,pregnancy outcomes and incidence of ovarian hyperstimulation syndrome (OHSS) of the two methods of treatment were compared between two groups.ResultsThere were 275 cycles in IVM group and 342 cycles in IVF/ICSI group established embryo transfer.The transplantation rate was 93.9％(275/293)in IVM group and 83.8％ (342/408) in IVF/ICSI,which reached statistical difference (P ＜ 0.01 ).The maturation rate of 56.64％,cleavage rate of 88.08％,high quality embryo rate of 38.72％ and embryo implantation rate of 17.8％ in IVM group were significantly lower than 91.09％,94.91％,51.50％ and 25.4％ in IVF/ICSI group (all P ＜ 0.01 ).The clinical pregnancy rate per transfer were 37.8％ (104/275) in IVM group and 44.2％ (151/342) in IVF/ICSI group,which did not show statistical difference (P＞0.05).The mean number of oocytes ( 12.9 ±6.5 vs.12.9 ±7.9) and fertilization rate (76.52％ vs.70.75％ ) didn't show significant difference between IVM group and IVF/ICSI group ( P ＞ 0.05 ).The 21.3％ ( 87/408 ) cycles presented mild to moderate OHSS and 2.0％cycles(8/408)presented severe OHSS in IVF/ICSI group.While,no OHSS cycles were observed in IVM group.Conclusion IVM could get similar clinical pregnancy rates compared with IVF/ICSI in patient with PCOS,however,it can avoid occurrence of OHSS.

Objective To determine whether the small intestinal submucosa(SIS)/nano meter crystal ?-tricalcium phosphate(nm ?-TCP) composite can enhance the regeneration of rabbit mandibular defects. Methods Twenty-six mandibular defects were made on thirteen New Zealand rabbits,and were ramdonly divided into four groups: groupⅠ,single SIS was applied to each defects;group Ⅱ,nm ?-TCP;groupⅢ,the composite scaffold materials of SIS and nm ?-TCP;groupⅣ,control.Twelve weeks after the operation,the samples were extracted for gross observation,histological analysis,X-ray examination,and relative bone density(RBD) recording.Results Twenty weeks after the operation,the newborn bone trabecula took up most of the area with defects.The restorative materials in the SIS group and composite scaffold materials group had almost degraded,and little remained in the ?-TCP group.The composite scaffold materials group was found more newborn bone trabecula with mature formation,and the average RBD was relatively higer,while less newborn bone trabecula with irregular formation and more collagen were observed in the control group. Conclusion The composite materials of SIS and nm ?-TCP,which enjoy favourable bone formation characteristics and histocompatibility, can enhance bone regeneration in rabbit mandibular defects.