1.Ependymoma of ovary: report of a case.
Kai-xuan YANG ; Yu WAN ; Lian XU ; Liang SUN ; Zheng-yu LI
Chinese Journal of Pathology 2007;36(8):568-569
Adult
;
Antineoplastic Combined Chemotherapy Protocols
;
therapeutic use
;
Cyclophosphamide
;
therapeutic use
;
Cystadenocarcinoma, Papillary
;
pathology
;
Dactinomycin
;
therapeutic use
;
Diagnosis, Differential
;
Ependymoma
;
drug therapy
;
metabolism
;
pathology
;
surgery
;
Female
;
Follow-Up Studies
;
Glial Fibrillary Acidic Protein
;
metabolism
;
Humans
;
Hysterectomy
;
Ovarian Neoplasms
;
drug therapy
;
metabolism
;
pathology
;
surgery
;
Ovariectomy
;
Teratoma
;
pathology
;
Vimentin
;
metabolism
;
Vincristine
;
therapeutic use
2.Preliminary study of odor change mechanism in Crataegi fructus stir-fried process based on correlation analysis.
Liang LI ; Shi-Long YANG ; Yu-Jie LIU ; Yun-Wei WSNG ; Lian ZHONG ; Li AI
China Journal of Chinese Materia Medica 2014;39(17):3283-3286
In order to investigate the mechanism, the correlation between the odor change in Crataegi Fructus stir-fried process and 5-HMF were studied. Required samples were retrieved from Crataegi Fructus stir-fried process. Statistical quality control (SQC) was used to analyze the response values acquired by the electronic nose. At the same time, the content of 5-HMF was detected by high performance liquid chromatography (HPLC). Correlation analysis was used to analyze the relationship between the above two. Experimental results showed that SQC model established by response values of all samples could show the change law of odor in Crataegi Fructus stir-fried process and changes of 5-HMF content was dropped after the first increase. Correlation analysis showed that the odor change in Crataegi Fructus stir-fried process and 5-HMF were significantly correlated (P < 0.05). Sugar degradation reaction and the Maillard reaction may be one of the mechanisms of the odor change in Crataegi Fructus stir-fried process.
Chromatography, High Pressure Liquid
;
Crataegus
;
chemistry
;
Furaldehyde
;
analogs & derivatives
;
analysis
;
Hot Temperature
;
Odorants
;
analysis
;
Plant Extracts
;
analysis
;
Technology, Pharmaceutical
;
methods
3.Study on the quantitative change of anthraquinonoids of Rhei in the preparation of dachengqi.
Yuan-er ZENG ; Feng-lian CHENG ; Liang-wen YU
China Journal of Chinese Materia Medica 2002;27(1):60-62
OBJECTIVETo study the scientific evidence of the traditional preparation of Dachengqi: "Boiling Aurantii Immaturus and Magnoliae Officinalis first, and then adding Rhei to decoct together. Discarding the dregs, adding Natrii Sulfas into the decoction and drinking the upper solution when the Natrii Sulfas has dissolved completely".
METHODThe concentrations of free and combined anthraquinonoids(emodin, rhein, chrysophanol, physcion) in different decoctions were determined with HPLC method respectively.
RESULTWhen Natrii Sulfas, Aurantii Immaturus and Magnolias Officinalis are decocted with Rhei in different schemes, the concentrations of anthraquinonoids were changed regularly.
CONCLUSIONThe scientific evidence of traditional preparation method greatly increased the concentrations of the active components in Dachengqi.
Anthraquinones ; analysis ; Citrus ; chemistry ; Drug Combinations ; Drugs, Chinese Herbal ; chemistry ; Emodin ; analogs & derivatives ; analysis ; Hot Temperature ; Magnolia ; chemistry ; Materia Medica ; chemistry ; Plant Extracts ; chemistry ; Plants, Medicinal ; chemistry ; Rheum ; chemistry ; Sulfates ; Time Factors
4.Influence of service-learning model on medical graduates' ethical behavioral tendency
Zhenhua LIN ; Yizhen LUO ; Lina YU ; Xingji LIAN ; Qian LIANG ; Liping LI
Chinese Journal of Medical Education Research 2013;(12):1192-1194,1195
Objective To investigate the influence of service-learning model on medical graduates' ethical behavioral tendency. Methods A self-designed questionnaire was conducted among 302 medical students who have graduated in the last five years including the basic information, ethical behavioral tendency and participation of service-learning. The acquired data was analyzed and com-pared using chi-square test and unconditional logistic multiple regression. Results 68.2%(206/302) undergraduates participated in service-learning. Undergraduates participated in service-learning be-haved more ethical than those did not participated when facing the situation of patient' vomits (P=0.037). There were statistical differences in taking bribes from patients between those participated in service-learning and those did not (P=0.031). According to the results of unconditional logistic multiple regression analysis, whether participating in the service-learning is one of significant factors influenc-ing undergraduates' attitude towards bride-taking. Conclusions Medical students educated by service-learning model will exhibited more ethically accepted medical behaviors after becoming doctors. Ser-vice-learning model, a new medical education model, is worth promoting.
5.Metal stents in the treatment of neoplasm causing bronchial obstruction.
Guo-liang SHAO ; Chuan-ding YU ; Yu-tang CHEN ; Yan-ping YU ; Qi-rong XIA ; Wei-sheng LIAN
Chinese Journal of Oncology 2005;27(7):444-445
Aged
;
Bronchoscopy
;
Esophageal Neoplasms
;
complications
;
Female
;
Humans
;
Male
;
Middle Aged
;
Stents
;
Thyroid Neoplasms
;
complications
;
Tracheal Stenosis
;
etiology
;
therapy
6.Treating irritable bowel syndrome by wuling capsule combined pinaverium bromide: a clinical research.
Xiao-wei WU ; Yu HOU ; Hong-zan JI ; Ming-ming LIANG ; Lian-e XU ; Fang-yu WANG
Chinese Journal of Integrated Traditional and Western Medicine 2015;35(4):415-418
OBJECTIVETo evaluate the efficacy and safety of wuling Capsule combined with Pinaverium Bromide in treatment of irritable bowel syndrome (IBS).
METHODSSixty-four IBS patients were randomized into two groups, the treatment group and the control group, 32 in each group. Patients in the treatment group took wuling Capsule (0. 33 g/capsule, 3 times per day) and Pinaverium Bromide (50 mg/tablet, one tablet each time, 3 times per day) , while those in the control group only took Pinaverium Bromide (50 mg/tablet, one tablet each time, 3 times per day). The therapeutic course for all was 6 weeks. IBS symptom score questionnaire, IBS-Quality of Life (IBS-QOL) , Self-Rating Depression Scale (SDS) , and Self-Rating Anxiety Scale (SAS) were assessed before and after treatment. Adverse reactions were also observed.
RESULTSThe improvement of abdominal pain, stool frequency, and stool properties, as well as changing rates of integrals were significantly higher in the treatment group than in the control group (P <0. 05). The improvement of dysphoria, body image, concerns for health, and dietary restriction of IBS-QOL, as well as changing rates of integrals were significantly higher in the treatment group than in the control group (P <0. 05). The improvement of SDS and SAS, as well as changing rates of integrals were significantly higher in the treatment group than in the control group (P <0. 05). No severe adverse reaction occurred in either group.
CONCLUSIONCombination therapy of wuling Capsule and Pinaverium Bromide could improve abdominal pain and defecation, attenuate depression and anxiety of IBS patients with higher safety.
Anxiety ; Anxiety Disorders ; Biomedical Research ; Capsules ; Defecation ; Depression ; Depressive Disorder ; Drugs, Chinese Herbal ; therapeutic use ; Humans ; Irritable Bowel Syndrome ; drug therapy ; Morpholines ; therapeutic use ; Quality of Life ; Surveys and Questionnaires
7.Evaluation of brachial plexus injury by MRI
Jian-Yu CHEN ; Qing-Yu LIU ; Jun SHEN ; Bi-Ling LIANG ; Ming-Yong GAO ; Rui-Xin YE ; Jing-Lian ZHONG ;
Chinese Journal of Radiology 1994;0(06):-
Objective To evaluate the diagnostic value of MRI in brachial plexus injury.Methods Total 98 patients with brachial plexus injury were examined by MRI before operation.Fifty-four of 98 patients MR imaging were obtained by 0.5 Tesla scanner and other 44 patients were obtained by 1.5 Tesla scanner.The scanning sequences include: SE T_1WI,T_2WI,FFE T_2WI and T_2WI SPIR. Exploration of the supraclavicular plexus was carried out and the MR imaging were compared with the operative finding in 63 patients.Thirty-five patients who had not surgery were followed-up.Results MR imaging found pre-ganglionic injuries in 45 patients and post-ganglionic injuries in 56 patients.Pre-and post-ganglionic injuries simultaneously in 16 patients among them.MR imaging can not find injury sings in 13 patients.The positive rate was 86.73%.MR imaging finding of pre-ganglionic injuries include:(1) Spinal cord edema and hemorrhage,2 patients (4.44% ).(2)Displacement of spinal cord,17 patients (37.78%).(3)Traumatic meningoceles,37 patients (82.22%).(4)Absence of roots in spinal canal, 25 patients(55.56% ).(5)Scarring in the spinal cnanl,24 patients (53.33%).(6)Denervation of erector spine,13 patients (28.89%).MR imaging finding of post-ganglionic injuries include:(1)Trunk thickening with hypointensities in T_2WI,23 patients (41.07%).(2)Nerve trunk complete loss of continuity with disappeared of nerve structure,16 patients (28.57%).(3)Continuity of nerve trunk was well with disappearance of nerve structure,14 patients(25.00%).(4)Traumatic neurofibroma,3 patients (5.36%).Conclusion MR imaging can reveal Pre-and post-ganglionic injuries of brachial plexus simultaneously.MR imaging is able to determine the location (pre-or post-ganglionic)and extent of brachial plexus injury,provided important information for treatment method selection.
8.Imaging diagnosis of aneurysmal bone cyst secondary to giant cell tumor
Jian-Yu CHEN ; Qing-Yu LIU ; Jun SHEN ; Bi-Ling LIANG ; Rui-Xin YE ; Jing-Lian ZHONG ;
Chinese Journal of Radiology 2000;0(12):-
Objective To improve recognition and imaging diagnosis of aneurysmal bone cyst secondary to a giant cell tumor.Methods To collect the dates of 12 patients with aneurysmal bone cyst secondary to a giant cell tumor were proved by operation and pathology from January 2003 to October 2006. Analyzed and summarized their imaging manifestations and correlation with pathohistology.Results Six lesions were located in epiphysis and metaphysic regions of long bone.Six lesions were located in pelvis.All cases showed a cystic lesion with expanded and osteolytic,eccentric 10 cases and centric 2 cases.Four cases display trabeculate,the margin is well define with a rim of bone sclerosis in 2 cases.Magnetic resonance imaging(MRI)scans were available in 10 patients.All case showed cystic,dilated lesions with solid areas. Eight cases manifested single or multitude solid nodules in big cystic wall.Two cases appeared solid masses with multitude cysts.The sign of multitude fluid-fluid level,best seen on T_2-weighted images,was present in all patients.Seven cases emerged soft-tissue masses.MR found indicative of large amounts of hemosiderin in one cases.Eight cases were examined by spiral CT with plain scanning and enhancement scanning. Reconstructed image were CTA and 3D-MPR(three dimensions multiplanar reconstruction)imaging.All cases showed cystic,dilated lesions with solid areas.The sign of multitude fluid-fluid level was present in 6 patients.The solid areas and cystic-wall of lesions showed contrast enhancement in 8 patients.3D-MPR imaging showed supply blood vessel of tumors in 3 cases.Arteriovenous malformation did not found in all patients.The surgeons'operative findings and the gross specimens were studied in all patients.All lesions were composed of solid areas and cystic areas.The diagnosis of pathology were ABC with GCT(grade Ⅱ)in 10 cases and ABC with GCT(grade Ⅲ).Conclusion Aneurysmai bone cyst secondary to a giant cell tumor is not rare.Adequately recognizing the pathologic basis of ABC,and selecting imaging techniques correctly (X-ray and MRI,or X-ray and CT)is especially important to diagnose a giant-cell tumor with secondary aneurysmai bone cyst.When an eccentric,expanded,lytic tumor with a cystic-solid lesion in epiphysis of long bone or pelvis shows multiple fluid levels,a giant-cell tumor with secondary aneurysmai bone cyst components should be sufficiently considered.
9.Expression of B lymphocyte stimulator in peripheral blood mononuclear cells in individuals with systemic lupus erythematosus and the role of interferon-? on it's expression
Yu-Jin YE ; Han-Shi XU ; Liu-Qin LIANG ; Pei-Da YIN ; Xiu-Yan YANG ; Zhong-Ping ZHAN ; Fan LIAN ;
Chinese Journal of Rheumatology 2003;0(10):-
Objective To determine the expression of membrane-bound B lymphocyte stimulator (BLyS) protein and its mRNA in vitro of peripheral blood mononuclear cells (PBMCs) from individuals with systemic lupus erythematosus (SLE),and to investigate the role of interferon-?(IFN-?) on the expression of BLyS.Methods PBMCs were obtained from 25 SLE patients (mean age of 31+14) and 20 healthy volunteers (mean age of 28?10).They were randomized into IFN-?(5 ng/ml) group and control group.PBMCs were col- lected at 0,6,12 and 24 h for BLyS mRNA assessment using semi-quantitative reverse transcription-PCR (RT-PCR).PBMCs were also collected at 72 h for membrane-bound BLyS protein detection using flow cy- tometry (FACS) and direct immunofluorescence.Results①The expression of BLyS mRNA and membrane- bound protein in PBMCs was significantly higher in individuals with SLE compared with healthy controls (P<0.05);②IFN-?enhanced BLyS mRNA expression in PBMCs in both healthy controls and SLE patients,with the greatest effect at 6 h (stimulated vs unstimulated,0.42?0.19 vs 0.25?0.14,P<0.01;0.59?0.28 vs 0.44?0.21,P<0.01 );③IFN-?also increased the expression of membrane-bound BLyS protein in both healthy con- trols and individuals with SLE (FACs,mean fluorescence intensity,4.5+3.0 vs 3.7~2.6,P
10.Molecular genetic analysis of FUT1 and FUT2 gene in para-Bombay Chinese: a novel FUT1 allele is identified.
Yu qing SU ; Tian-li WEI ; Qiong YU ; Yan-lian LIANG ; Da-cheng LI
Chinese Journal of Medical Genetics 2007;24(5):520-523
OBJECTIVEMolecular genetic analysis of FUT1 and FUT2 gene was performed for seven Chinese Han individuals serologically typed as para-Bombay.
METHODSSeven DNA samples were studied by polymerase chain reaction and then by direct sequencing. Molecular cloning sequencing was done for an individual with a novel FUT1 allele. Family segregation analysis of the novel FUT1 allele was done to explore whether the allele was responsible for the fucosyltransferase defects of H.
RESULTSThe FUT1 genotypes of seven para-Bombay individuals were h1h1 (four individuals), h2h2 (two individuals), h328hnew (one individual), alleles h1 lost one of the three AG repeats located at the nucleotides 547-552 of the FUT1 gene, h2 lost two of the three T repeats located at the nucleotides 880-882, h328 (nt328G>A) was a missense mutation, all of them were known mutations, while allele hnew deleted GGTATTCCGCATCACCCTGCCCGTGCTGGCCCC at nt360-400, total 33 bases, and the frame-shift mutation was not previously reported. The segregation of the hnew allele in his family showed that his father genotype was Hh328, and his mother was Hhnew, while two brother were h328hnew. The FUT2 genotypes of seven para-Bombay individuals were Se357 Se357 (three individuals), Se357 Se357,385 (three individuals), Se357,716Se357,716(one individual), the functional Se357(nt357C>T), Se716(nt716G>A) and the weakly functional Se385(nt385A>T) were known. The seven para-Bombay individuals carried at least one copy of a functional FUT2 allele was consistent with their secretor status.
CONCLUSIONA novel FUT1 allele was identified in a para-Bombay Chinese individual, which was responsible for the inactivation of the FUT1-encoded enzyme activity.
Alleles ; Asian Continental Ancestry Group ; genetics ; Base Sequence ; Ethnic Groups ; genetics ; Fucosyltransferases ; genetics ; Genotype ; Humans ; Pedigree ; Phenotype ; Polymerase Chain Reaction ; Sequence Analysis, DNA ; Serologic Tests