OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Addressing the enduring challenge of evaluating traditional Chinese medicines (TCMs), the integrated evidence chain-based effectiveness evaluation of TCMs (Eff-iEC) has emerged. This paper explored its capacity through a demonstration study that evaluated the effectiveness evidence of six commonly used anti-hepatic fibrosis Chinese patent medicines (CPMs), including Biejiajian Pill (BP), Dahuang Zhechong Pill (DZP), Biejia Ruangan Compound (BRC), Fuzheng Huayu Capsule (FHC), Anluo Huaxian Pill (AHP), and Heluo Shugan Capsule (HSC), using both Eff-iEC and the Grading of Recommendations, Assessment, Development, and Evaluation (GRADE) system. The recognition of these CPMs within the TCM academic community was also assessed through their inclusion in relevant medical documents. Results showed that the evidence of BRC and FHC received higher assessments in both Eff-iEC and GRADE system, while the assessments for others varied. Analysis of community recognition revealed that Eff-iEC more accurately reflects the clinical value of these CPMs, exhibiting superior evaluative capabilities. By breaking through the conventional pattern of TCMs effectiveness evaluation, Eff-iEC offers a novel epistemology that better aligns with the clinical realities and reasoning of TCMs, providing a coherent methodology for clinical decision-making, new drug evaluations, and health policy formulation.

BACKGROUND: The use of inserted sham acupuncture as a placebo in randomized controlled trials (RCTs) is controversial, because it may produce specific effects that cause an underestimation of the effect of acupuncture treatment. OBJECTIVE: This systematic survey investigates the magnitude of insert-specific effects of sham acupuncture and whether they affect the estimation of acupuncture treatment effects. SEARCH STRATEGY: PubMed, Embase and Cochrane Central Register of Controlled Trials were searched to identify acupuncture RCTs from their inception until December 2022. INCLUSION CRITERIA: RCTs that evaluated the effects of acupuncture compared to sham acupuncture and no treatment. DATA EXTRACTION AND ANALYSIS: The total effect measured for an acupuncture treatment group in RCTs were divided into three components, including the natural history and/or regression to the mean effect (controlled for no-treatment group), the placebo effect, and the specific effect of acupuncture. The first two constituted the contextual effect of acupuncture, which is mimicked by a sham acupuncture treatment group. The proportion of acupuncture total effect size was considered to be 1. The proportion of natural history and/or regression to the mean effect (PNE) and proportional contextual effect (PCE) of included RCTs were pooled using meta-analyses with a random-effect model. The proportion of acupuncture placebo effect was the difference between PCE and PNE in RCTs with non-inserted sham acupuncture. The proportion of insert-specific effect of sham acupuncture (PIES) was obtained by subtracting the proportion of acupuncture placebo effect and PNE from PCE in RCTs with inserted sham acupuncture. The impact of PIES on the estimation of acupuncture's treatment effect was evaluated by quantifying the percentage of RCTs that the effect of outcome changed from no statistical difference to statistical difference after removing PIES in the included studies, and the impact of PIES was externally validated in other acupuncture RCTs with an inserted sham acupuncture group that were not used to calculate PIES. RESULTS: This analysis included 32 studies with 5492 patients. The overall PNE was 0.335 (95% confidence interval [CI], 0.255-0.415) and the PCE of acupuncture was 0.639 (95% CI, 0.567-0.710) of acupuncture's total effect. The proportional contribution of the placebo effect to acupuncture's total effect was 0.191, and the PIES was 0.189. When we modeled the exclusion of the insert-specific effect of sham acupuncture, the acupuncture treatment effect changed from no difference to a significant difference in 45.45% of the included RCTs, and in 40.91% of the external validated RCTs. CONCLUSION The insert-specific effect of sham acupuncture in RCTs represents 18.90% of acupuncture's total effect and significantly affects the evaluation of the acupuncture treatment effect. More than 40% of RCTs that used inserted sham acupuncture would draw different conclusions if the PIES had been controlled for. Considering the impact of the insert-specific effect of sham acupuncture, caution should be taken when using inserted sham acupuncture placebos in RCTs. Please cite this article as: Luo XC, Liu JL, Yao MH, Chen YM, Fan AY, Liang FR, Zhao JP, Zhao L, Zhou X, Zhong XY, Yang JH, Li B, Zhang Y, Sun X, Li L. Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey. J Integr Med. 2025; 23(6):630-640.
Acupuncture Therapy/methods* ; Humans ; Randomized Controlled Trials as Topic ; Placebo Effect ; Placebos ; Treatment Outcome

Objective To evaluate the efficacy and safety of Chinese patent medicine combined with inhalation therapy for bronchial asthma in children with network meta-analysis.Methods CNKI,CBM,Wanfang Data,VIP,Embase,PubMed,and Web of Science were searched for obtaining the clinical randomized controlled trials of Chinese patent medicine combined with inhalation therapy for the treatment of bronchial asthma in children.Stata14 was used for network meta-analysis of the data.Results A total of 28 studies were eventually included,involving seven kinds of Chinese patent medicines,namely Hanchuan Zupa Granules,Huaiqihuang Granules,Tanreqing Injection,Xiaoer Feire Kechuan Granules,Chuankezhi Injection,Yupingfeng Granules and Zhubei Dingchuan Pills.The results of network meta-analysis showed that for improving the total effective rate,Tanreqing Injection combined with inhalation therapy,Chuankezhi Injection combined with inhalation therapy,and Zhubei Dingchuan Pills combined with inhalation therapy had the top 3 rankings of surface under the cumulative ranking curve(SUCRA).The optimal intervention measures to improve the peak expiratory flow(PEF),forced expiratory volume at one second(FEV1),and the ratio of FEV1 to forced vital capacity(FEV1/FVC)may separately be Tanreqing Injection combined with inhalation therapy,Hanchuan Zupa Granules combined with inhalation therapy,and Zhubei Dingchuan Pills combined with inhalation therapy.The analysis of the SUCRA ranking of the incidence of adverse reactions showed that Xiaoer Feire Kechuan Granules combined with inhalation therapy may be the intervention with the least side effects,and Zhubei Dingchuan Pills combined with inhalation therapy may be the intervention with greater side effects.Conclusion Compared with inhalation therapy alone,Chinese patent medicine combined with inhalation therapy can enhance the effective rate of bronchial asthma in children and improve lung function indicators,and has good safety.

Objective To observe the efficacy of Chinese medicine in the treatment of pregnancy complicated with thalassemia and to investigate its influence on pregnancy outcomes.Methods A retrospective cohort study was carried out in 175 pregnant women complicated with thalassemia who met the inclusion criteria.According to the treatment methods,the patients were divided into Chinese medicine group(105 cases),iron supplementation group(41 cases)and untreated group(29 cases).The changes of hematological indicators and pregnancy outcomes in the second and third trimesters of pregnancy were compared among the three groups.The Chinese medicine group was further divided into three subgroups:56 cases in the Chinese patent medicine group,20 cases in the single Chinese medicine group and 29 cases in the Chinese herbal compound group.The changes of hematological indexes in the second and third trimesters of pregnancy in the three subgroups were compared.Moreover,the normative management of pregnant women with thalassemia during pregnancy was explored.Results(1)The concentration of hemoglobin(Hb)in the third trimester of the Chinese medicine group was(2.28±7.27)g/L higher than that in the second trimester,and the curative effect of Chinese medicine group was superior to that in the iron supplementation group and the untreated group(P＜0.05).The Hb concentration in the Chinese medicine group before delivery was(12.17±10.81)g/L higher than that in the second trimester,and the increase in the Chinese medicine group was more significantly than that in the other two groups(P＜0.05).(2)The level of serum ferritin(FER)in the third trimester of the three groups was lower than that in the second trimester,and the decrease of FER level in the iron supplementation group was less significantly than that in the other two groups(P＜0.05).(3)The Hb concentration in the third trimester of the single Chinese medicine group and the Chinese herbal compound group increased by(4.50±4.66),(3.62±8.77)g/L respectively compared with that in the second trimester,and the increase in the above two groups was more significantly than that in the Chinese patent medicine group(P＜0.05).(4)There was no significant difference in pregnancy outcomes among the three groups of pregnant women with thalassemia(P＞0.05).(5)Only 52.0％(91/175)of pregnant women with thalassemia underwent three or more blood routine tests after 20-24 weeks of pregnancy,34.3％(60/175)of pregnant women failed in re-examining the FER levels,and 21.2％(37/175)of pregnant women had no standardized iron supplementation.Conclusion Chinese medicine therapy is effective on improving anemia in pregnant women with thalassemia.Chinese herbal compound and single Chinese medicinal are more effective than Chinese patent medicine,and have not increased the risk of adverse pregnancy outcomes.Oral administration of iron can increase the iron reserve of pregnant women with thalassemia,but its effect on improving anemia is not as good as that of Chinese medicine.Attention should be got to the monitoring of anemia and iron metabolism indicators as well as the standardized use of iron supplements and Chinese patent medicines in pregnant women with thalassemia.

Objective To explore characteristics of co-infection of Chlamydia pneumoniae(Cpn)and severe acute respiratory syndrome coronavirus 2(SARS-CoV-2),and identify their effect on SARS-CoV-2-induced inflammatory response.Methods Patients with coronavirus disease 2019(COVID-19)who received treatment in a hospital in Chenzhou City from December 20,2022 to February 20,2023 were selected.According to the severity of COVID-19,severe and critical cases were classified as the severe symptom group,while mild and moderate cases were classified as the mild symptom group.Meanwhile,according to the age of patients(≥18 years old as adults,＜18 years old as juveniles),they were divided into the adult severe symptom group,adult mild symptom group,juvenile severe symptom group,and juvenile mild symptom group.Propensity score was adopted to match age,gender,and under-lying diseases of patients in severe symptom and mild symptom group in a 1∶1 ratio.Bronchoalveolar lavage fluid(BALF),throat swabs,and serum specimens of patients were collected.Cpn IgG/IgM antibody was detected by enzyme-linked immunosorbent assay(ELISA),levels of 12 common cytokines(including interleukin-8[IL-8])in BALF were detected by flow cytometry,differences among groups were compared.Results A total of 102 patients were included,with 61 severe and critical(severe symptom)patients,as well as 41 mild and moderate(mild symp-tom)patients.There were 71 patients aged ≥18 years and 31 juvenile patients aged＜18 years.There were 39 pa-tients in the adult severe symptom group and 32 in the adult mild symptom group,and 30 pairs were successfully matched through propensity score analysis.There were 22 patients in the juvenile severe symptom group and 9 in the juvenile mild symptom group,and 8 pairs were successfully matched through propensity score analysis.Among COVID-19 patients,the positive rates of Cpn IgG and IgM were 36.27％(n=37)and 8.82％(n=9),respective-ly,with 1 case positive for both Cpn IgG and IgM.The level of interferon(IFN)-α in serum specimens from adult patients with severe symptom combined with positive Cpn IgG was higher than that of IgG negative patients(P=0.037).There was no statistically significant difference in the levels of other cytokines in BALF and serum speci-mens between the two groups of patients(all P＞0.05).The levels of IL-8 and IL-17 in serum specimens of patients with positive Cpn IgG in the adult mild symptom group were both higher than those in Cpn IgG negative patients(both P＜0.05).The levels of IL-8 in both BALF and serum specimens from Cpn IgM positivity patients in the ju-venile mild symptom group were higher than those from patients with negative Cpn IgM(both P＜0.05).Logistic regression analysis results showed that Cpn IgG and IgM positivity were not risk factors for the development of se-vere COVID-19.Conclusion Combined Cpn infection is not a risk factor for the development of severe symptom in COVID-19 patients,and Cpn infection has limited impact on the secretion of inflammatory factors caused by SARS-CoV-2.

Patients with severe trauma require an extremely timely treatment and transfusion plays an irreplaceable role in the emergency treatment of such patients. An increasing number of evidence-based medicinal evidences and clinical practices suggest that patients with severe traumatic bleeding benefit from early transfusion of low-titer group O whole blood or hemostatic resuscitation with red blood cells, plasma and platelet of a balanced ratio. However, the current domestic mode of blood supply cannot fully meet the requirements of timely and effective blood transfusion for emergency treatment of patients with severe trauma in clinical practice. In order to solve the key problems in blood supply and blood transfusion strategies for emergency treatment of severe trauma, Branch of Clinical Transfusion Medicine of Chinese Medical Association, Group for Trauma Emergency Care and Multiple Injuries of Trauma Branch of Chinese Medical Association, Young Scholar Group of Disaster Medicine Branch of Chinese Medical Association organized domestic experts of blood transfusion medicine and trauma treatment to jointly formulate Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients ( version 2024). Based on the evidence-based medical evidence and Delphi method of expert consultation and voting, 10 recommendations were put forward from two aspects of blood support mode and transfusion strategies, aiming to provide a reference for transfusion resuscitation in the emergency treatment of severe trauma and further improve the success rate of treatment of patients with severe trauma.

Objective: Schizophrenia is a complex and devastating psychiatric disorder with a strong genetic background. However, much uncertainty still exists about the role of genetic susceptibility in the pathophysiology of schizophrenia. TEA domain transcription factor 1 (TEAD1) is a transcription factor associated with neurodevelopment and has modulating effects on various nervous system diseases. In the current study, we performed a case–control association study in a Northeast Chinese Han population to explore the characteristics of pathogenic TEAD1 polymorphisms and potential association with schizophrenia. Methods: We recruited a total of 721 schizophrenia patients and 1,195 healthy controls in this study. The 9 single nucleotide polymorphisms (SNPs) in the gene region of TEAD1 were selected and genotyped. Results: The genetic association analyses showed that five SNPs (rs12289262, rs6485989, rs4415740, rs7113256, and rs1866709) were significantly different between schizophrenia patients and healthy controls in allele or/and genotype frequencies. After Bonferroni correction, the association of three SNPs (rs4415740, rs7113256, and rs1866709) with schizophrenia were still evident. Haplotype analysis revealed that two strong linkage disequilibrium blocks (rs6485989-rs4415740-rs7113256 and rs16911710-rs12364619-rs1866709) were globally associated with schizophrenia. Four haplotypes (C-C-C and T-T-T, rs6485989-rs4415740-rs7113256; G-T-A and G-T-G, rs16911710-rs12364619-rs1866709) were significantly different between schizophrenia patients and healthy controls. Conclusion The current findings indicated that the human TEAD1 gene has a genetic association with schizophrenia in the Chinese Han population and may act as a susceptibility gene for schizophrenia.

Objective:To evaluate the severe occlusal surface wear of implant-supported full-arch prostheses, and to explore the risk factors affecting the severe occlusal surface wear of implant-supported full-arch prostheses.Methods:Five hundred and thirty-five patients who received implant-supported fixed complete dental prostheses or implant-overdentures and completed at least one follow-up 3 months after the delivery of definitive prostheses were enrolled from October 1994 to October 2021 in this retrospective cohort study. The information on demographics, implants, definitive prostheses, and related outcomes was collected. Cox proportional hazard regression model was adopted to analyze the risk factors of the severe wear of occlusal surfaces in implant-supported full-arch prostheses. Univariate analysis was performed on the factors that may affect the severe wear of occlusal surfaces, and the parameters of P<0.10 in univariate analysis were included in multivariate analysis to explore the risk factors affecting the severe wear of occlusal surfaces in implant-supported full-arch prostheses. Results:Severe wear of the posterior occlusal surfaces was detected in 114 prostheses with a duration of 61.4 (33.3, 89.4) months. 13 cases occurred ≤2 years after the delivery of definitive prostheses, 44 cases>2 years and ≤5 years, 44 cases>5 years and ≤10 years, and the other 13 cases>10 years. There was no significant difference in the average time of severe occlusal surface wear between implant-supported fixed complete dental prostheses and implant-overdentures in the maxilla ( Z=-1.03, P=0.303). However, in the mandible, it was 48.2 (31.2, 80.2) and 79.2 (51.3, 119.1) months respectively, which was statistically significant ( Z=-2.93, P=0.003). Cox proportional hazard regression model showed opposed fixed dentition, bruxism, and posterior resin occlusal surfaces were risk factors ( P<0.05) affecting the severe wear of the occlusal surfaces. Conclusions:Severe occlusal surface wear was clinically common with the prolonged application of implant-supported full-arch prostheses. Prostheses opposed to fixed dentition, in patients with bruxism, and made of posterior resin materials were at higher risk of severe occlusal surface wear on the posterior artificial teeth. Regular follow-up, patients′ behavior guidance, and clinicians′ appropriate intervention were necessary to manage this complication.