Tumor drug resistance is an important problem in the failure of chemotherapy and targeted drug therapy, which is a complex process involving chromatin remodeling. SWI/SNF is one of the most studied ATP-dependent chromatin remodeling complexes in tumorigenesis, which plays an important role in the coordination of chromatin structural stability, gene expression, and post-translation modification. However, its mechanism in tumor drug resistance has not been systematically combed. SWI/SNF can be divided into 3 types according to its subunit composition: BAF, PBAF, and ncBAF. These 3 subtypes all contain two mutually exclusive ATPase catalytic subunits (SMARCA2 or SMARCA4), core subunits (SMARCC1 and SMARCD1), and regulatory subunits (ARID1A, PBRM1, and ACTB, etc.), which can control gene expression by regulating chromatin structure. The change of SWI/SNF complex subunits is one of the important factors of tumor drug resistance and progress. SMARCA4 and ARID1A are the most widely studied subunits in tumor drug resistance. Low expression of SMARCA4 can lead to the deletion of the transcription inhibitor of the BCL2L1 gene in mantle cell lymphoma, which will result in transcription up-regulation and significant resistance to the combination therapy of ibrutinib and venetoclax. Low expression of SMARCA4 and high expression of SMARCA2 can activate the FGFR1-pERK1/2 signaling pathway in ovarian high-grade serous carcinoma cells, which induces the overexpression of anti-apoptosis gene BCL2 and results in carboplatin resistance. SMARCA4 deletion can up-regulate epithelial-mesenchymal transition (EMT) by activating YAP1 gene expression in triple-negative breast cancer. It can also reduce the expression of Ca²⁺ channel IP3R3 in ovarian and lung cancer, resulting in the transfer of Ca²⁺ needed to induce apoptosis from endoplasmic reticulum to mitochondria damage. Thus, these two tumors are resistant to cisplatin. It has been found that verteporfin can overcome the drug resistance induced by SMARCA4 deletion. However, this inhibitor has not been applied in clinical practice. Therefore, it is a promising research direction to develop SWI/SNF ATPase targeted drugs with high oral bioavailability to treat patients with tumor resistance induced by low expression or deletion of SMARCA4. ARID1A deletion can activate the expression of ANXA1 protein in HER2+ breast cancer cells or down-regulate the expression of progesterone receptor B protein in endometrial cancer cells. The drug resistance of these two tumor cells to trastuzumab or progesterone is induced by activating AKT pathway. ARID1A deletion in ovarian cancer can increase the expression of MRP2 protein and make it resistant to carboplatin and paclitaxel. ARID1A deletion also can up-regulate the phosphorylation levels of EGFR, ErbB2, and RAF1 oncogene proteins.The ErbB and VEGF pathway are activated and EMT is increased. As a result, lung adenocarcinoma is resistant to epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs). Although great progress has been made in the research on the mechanism of SWI/SNF complex inducing tumor drug resistance, most of the research is still at the protein level. It is necessary to comprehensively and deeply explore the detailed mechanism of drug resistance from gene, transcription, protein, and metabolite levels by using multi-omics techniques, which can provide sufficient theoretical basis for the diagnosis and treatment of poor tumor prognosis caused by mutation or abnormal expression of SWI/SNF subunits in clinical practice.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

This consensus will introduce the characteristics of fillers used in the surgical cavities of domestic nasal surgery patients based on relevant literature and expert opinions. It will also provide recommendations for the selection of cavity fillers for different nasal diseases, with chronic sinusitis as a representative example.
Humans ; Nasal Cavity/surgery* ; Nasal Surgical Procedures ; China ; Consensus ; Sinusitis/surgery* ; Dermal Fillers

Allergen-specific immunotherapy（AIT） remains the only therapeutic approach with the potential to modify the natural course of allergic rhinitis（AR）. Nevertheless, considerable inter-individual variability exists in patients'responses to AIT. To facilitate more reliable assessment of treatment efficacy, the China Rhinopathy Research Cooperation Group（CRRCG） convened young and middle-aged nasal experts in China to formulate the present consensus. The recommended subjective outcome measures for AIT comprise symptom scores, medication scores, combined symptom and medication scores, quality-of-life assessments, evaluation of disease control, and assessment of comorbidities. Objective indicators may supplement these measures. Currently available objective approaches include skin prick testing, nasal provocation testing, and allergen exposure chambers. However, these methods remain constrained by practical limitations and are not yet appropriate for routine implementation in clinical efficacy evaluation. In addition, several biomarkers, including sIgE and the sIgE/tIgE ratio, sIgG4, serum IgE-blocking activity, IgA, cytokines and chemokines, as well as immune cell surface molecules and their functional activity, have been shown to have associations with AIT outcomes. While these biomarkers may complement subjective assessments, they are subject to significant limitations. Consequently, large-scale multicenter trials and real-world evidence are required to strengthen the evidence base. The present consensus underscores the necessity of integrating patients'subjective experiences with objective testing throughout the treatment process, thereby providing a more comprehensive and accurate framework for efficacy evaluation. Looking forward, future investigations should prioritize the incorporation of multi-omics data and artificial intelligence methodologies, which hold promise for overcoming current limitations in assessment strategies and for advancing both the standardization and personalization of AIT.
Humans ; Allergens/immunology* ; China ; Consensus ; Desensitization, Immunologic ; Immunoglobulin E ; Quality of Life ; Rhinitis, Allergic/therapy* ; Treatment Outcome ; East Asian People

Objective To investigate the impact of audio-visual impairments on subjective well-being(SWB),and whether the depressive tendency mediate the association between them.Methods The China Health and Retirement Longitudinal Survey(CHARLS)conducted a questionnaire survey on people aged 45 and above,using multi-stage sampling at the county(district)-village(residential)-household-individual level.In the county(district)-village(residential)level sampling,proportional probability sampling(PPS)was used according to population scale.This study was based on CHARLS data from 2018,and the inclusion criteria were(1)age≥60 years old;(2)having a complete self-reported visual and hearing condition;(3)at least one of the three subjective well-being indicators of life satisfaction,subjective life expectancy,and self-rated health status should be included.Likert five-component scale was used in CHARLS to measure the subjective well-being of the elderly,and the Center for Epidemiology Studies Depression Scale-10(CESD-10)was used to measure the depressive mood of the elderly.We used multiple regression to explore the association between vision and hearing impairment with depressive tendency and subjective well-being;and explored possible mediating effects through a mediation model.Two-side P values<0.05 were considered statistically significant.Results Finally,7 620 people who met the standards were included.Individuals with audio-visual impairments had significantly higher levels of depression and lower levels of all three SWB measurements(all P values<0.05).Single vision impairment(SVI),single hearing impairment(SHI)and double sensory impairment(DSI)were associated with more depression tendencies,lower self-rated health(SRH),and subjective life expectancy(SLE).SVI and DSI were associated with lower life satisfaction.Depressive tendency partially mediated the association of DSI with LS and the associations of SVI,SHI,and DSI with SLE and SRH.Conclusion Audio-visual impairments are independently associated with lower SWB status among the elderly in China,and depressive tendency plays a mediating role in these observed associations.

Objective:To standardize the management of auditory hallucination symptoms in inpatients with mental illness and develop an expert consensus on the management of auditory hallucinations in hospitalized psychiatric patients.Methods:From March 2023 to July 2023, the Mental Health Committee of the Chinese Nursing Association focused on the key issues in the management of auditory hallucinations symptoms in inpatients with mental illness, based on clinical practice, using literature analysis combined with the work experience of mental health experts, and formed the first draft of the expert consensus on the management of auditory hallucinations in inpatients with mental illness (hereinafter referred to as the consensus). Through 3 rounds of expert consultation and 3 rounds of expert demonstration meeting, the draft was adjusted, revised, and improved.Results:37 experts were included in the Delphi expert consultation, 1 male and 36 females with 39-67(51.48 ± 6.61) years old. The positive coefficients of experts in 3 rounds of Delphi expert consultations were all 100%, and the degrees of expert authority were 0.924, 0.938 and 0.949, respectively. The average importance value of each item was higher than 4.00, the variation coefficient of each item was less than 0.25. The Kendall harmony coefficient of the experts were 0.179, 0.195 and 0.198, respectively (all P<0.05). There were 15, 12, 12 experts in the first, seeond, third rounds of expert demonstration meeting. Finally, a consensus was reached on the recommendation of 4 parts, included auditory hallucination assessment, management format, symptom management implementation, and precautions. Conclusions:The consensus covers all parts of the management of auditory hallucination symptoms in hospitalized patients with mental disorders, which is practical and scientific. It is helpful to guide mental health professionals to standardize the management of auditory hallucination symptoms, improve the quality of nursing and ensure the safety of patients.

Objective To explore characteristics of co-infection of Chlamydia pneumoniae(Cpn)and severe acute respiratory syndrome coronavirus 2(SARS-CoV-2),and identify their effect on SARS-CoV-2-induced inflammatory response.Methods Patients with coronavirus disease 2019(COVID-19)who received treatment in a hospital in Chenzhou City from December 20,2022 to February 20,2023 were selected.According to the severity of COVID-19,severe and critical cases were classified as the severe symptom group,while mild and moderate cases were classified as the mild symptom group.Meanwhile,according to the age of patients(≥18 years old as adults,＜18 years old as juveniles),they were divided into the adult severe symptom group,adult mild symptom group,juvenile severe symptom group,and juvenile mild symptom group.Propensity score was adopted to match age,gender,and under-lying diseases of patients in severe symptom and mild symptom group in a 1∶1 ratio.Bronchoalveolar lavage fluid(BALF),throat swabs,and serum specimens of patients were collected.Cpn IgG/IgM antibody was detected by enzyme-linked immunosorbent assay(ELISA),levels of 12 common cytokines(including interleukin-8[IL-8])in BALF were detected by flow cytometry,differences among groups were compared.Results A total of 102 patients were included,with 61 severe and critical(severe symptom)patients,as well as 41 mild and moderate(mild symp-tom)patients.There were 71 patients aged ≥18 years and 31 juvenile patients aged＜18 years.There were 39 pa-tients in the adult severe symptom group and 32 in the adult mild symptom group,and 30 pairs were successfully matched through propensity score analysis.There were 22 patients in the juvenile severe symptom group and 9 in the juvenile mild symptom group,and 8 pairs were successfully matched through propensity score analysis.Among COVID-19 patients,the positive rates of Cpn IgG and IgM were 36.27％(n=37)and 8.82％(n=9),respective-ly,with 1 case positive for both Cpn IgG and IgM.The level of interferon(IFN)-α in serum specimens from adult patients with severe symptom combined with positive Cpn IgG was higher than that of IgG negative patients(P=0.037).There was no statistically significant difference in the levels of other cytokines in BALF and serum speci-mens between the two groups of patients(all P＞0.05).The levels of IL-8 and IL-17 in serum specimens of patients with positive Cpn IgG in the adult mild symptom group were both higher than those in Cpn IgG negative patients(both P＜0.05).The levels of IL-8 in both BALF and serum specimens from Cpn IgM positivity patients in the ju-venile mild symptom group were higher than those from patients with negative Cpn IgM(both P＜0.05).Logistic regression analysis results showed that Cpn IgG and IgM positivity were not risk factors for the development of se-vere COVID-19.Conclusion Combined Cpn infection is not a risk factor for the development of severe symptom in COVID-19 patients,and Cpn infection has limited impact on the secretion of inflammatory factors caused by SARS-CoV-2.

Patients with severe trauma require an extremely timely treatment and transfusion plays an irreplaceable role in the emergency treatment of such patients. An increasing number of evidence-based medicinal evidences and clinical practices suggest that patients with severe traumatic bleeding benefit from early transfusion of low-titer group O whole blood or hemostatic resuscitation with red blood cells, plasma and platelet of a balanced ratio. However, the current domestic mode of blood supply cannot fully meet the requirements of timely and effective blood transfusion for emergency treatment of patients with severe trauma in clinical practice. In order to solve the key problems in blood supply and blood transfusion strategies for emergency treatment of severe trauma, Branch of Clinical Transfusion Medicine of Chinese Medical Association, Group for Trauma Emergency Care and Multiple Injuries of Trauma Branch of Chinese Medical Association, Young Scholar Group of Disaster Medicine Branch of Chinese Medical Association organized domestic experts of blood transfusion medicine and trauma treatment to jointly formulate Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients ( version 2024). Based on the evidence-based medical evidence and Delphi method of expert consultation and voting, 10 recommendations were put forward from two aspects of blood support mode and transfusion strategies, aiming to provide a reference for transfusion resuscitation in the emergency treatment of severe trauma and further improve the success rate of treatment of patients with severe trauma.

Objective: This cross-sectional investigation aimed to determine the incidence, clinical characteristics, prognosis, and related risk factors of olfactory and gustatory dysfunctions related to infection with the SARS-CoV-2 Omicron strain in mainland China. Methods: Data of patients with SARS-CoV-2 from December 28, 2022, to February 21, 2023, were collected through online and offline questionnaires from 45 tertiary hospitals and one center for disease control and prevention in mainland China. The questionnaire included demographic information, previous health history, smoking and alcohol drinking, SARS-CoV-2 vaccination, olfactory and gustatory function before and after infection, other symptoms after infection, as well as the duration and improvement of olfactory and gustatory dysfunction. The self-reported olfactory and gustatory functions of patients were evaluated using the Olfactory VAS scale and Gustatory VAS scale. Results: A total of 35 566 valid questionnaires were obtained, revealing a high incidence of olfactory and taste dysfunctions related to infection with the SARS-CoV-2 Omicron strain (67.75%). Females(χ2=367.013, P<0.001) and young people(χ2=120.210, P<0.001) were more likely to develop these dysfunctions. Gender(OR=1.564, 95%CI: 1.487-1.645), SARS-CoV-2 vaccination status (OR=1.334, 95%CI: 1.164-1.530), oral health status (OR=0.881, 95%CI: 0.839-0.926), smoking history (OR=1.152, 95%CI=1.080-1.229), and drinking history (OR=0.854, 95%CI: 0.785-0.928) were correlated with the occurrence of olfactory and taste dysfunctions related to SARS-CoV-2(above P<0.001). 44.62% (4 391/9 840) of the patients who had not recovered their sense of smell and taste also suffered from nasal congestion, runny nose, and 32.62% (3 210/9 840) suffered from dry mouth and sore throat. The improvement of olfactory and taste functions was correlated with the persistence of accompanying symptoms(χ2=10.873, P=0.001). The average score of olfactory and taste VAS scale was 8.41 and 8.51 respectively before SARS-CoV-2 infection, but decreased to3.69 and 4.29 respectively after SARS-CoV-2 infection, and recovered to 5.83and 6.55 respectively at the time of the survey. The median duration of olfactory and gustatory dysfunctions was 15 days and 12 days, respectively, with 0.5% (121/24 096) of patients experiencing these dysfunctions for more than 28 days. The overall self-reported improvement rate of smell and taste dysfunctions was 59.16% (14 256/24 096). Gender(OR=0.893, 95%CI: 0.839-0.951), SARS-CoV-2 vaccination status (OR=1.334, 95%CI: 1.164-1.530), history of head and facial trauma(OR=1.180, 95%CI: 1.036-1.344, P=0.013), nose (OR=1.104, 95%CI: 1.042-1.171, P=0.001) and oral (OR=1.162, 95%CI: 1.096-1.233) health status, smoking history(OR=0.765, 95%CI: 0.709-0.825), and the persistence of accompanying symptoms (OR=0.359, 95%CI: 0.332-0.388) were correlated with the recovery of olfactory and taste dysfunctions related to SARS-CoV-2 (above P<0.001 except for the indicated values). Conclusion: The incidence of olfactory and taste dysfunctions related to infection with the SARS-CoV-2 Omicron strain is high in mainland China, with females and young people more likely to develop these dysfunctions. Active and effective intervention measures may be required for cases that persist for a long time. The recovery of olfactory and taste functions is influenced by several factors, including gender, SARS-CoV-2 vaccination status, history of head and facial trauma, nasal and oral health status, smoking history, and persistence of accompanying symptoms.
Female ; Humans ; Adolescent ; SARS-CoV-2 ; Smell ; COVID-19/complications* ; Cross-Sectional Studies ; COVID-19 Vaccines ; Incidence ; Olfaction Disorders/etiology* ; Taste Disorders/etiology* ; Prognosis

Humans ; Consensus ; Hypersensitivity ; Desensitization, Immunologic/adverse effects* ; Immunotherapy/adverse effects* ; Injections, Subcutaneous ; Allergens