Background/Aims: Endoscopic radiofrequency ablation (ERFA) is a treatment option for superficial esophageal squamous cell neoplasia (ESCN), with a relatively low risk of stenosis; however, the long-term outcomes remain unclear. We aimed to compare the long-term outcomes of patients with widespread superficial ESCN who underwent endoscopic submucosal dissection (ESD) or ERFA. Methods: We retrospectively analyzed the clinical data of patients with superficial ESCN who underwent ESD or ERFA between January 2015 and December 2021. The primary outcome measure was recurrence-free survival. Results: Ninety-two and 33 patients with superficial ESCN underwent ESD and ERFA, respectively. The en bloc, R0, and curative resection rates for ESD were 100.0%, 90.2%, and 76.1%, respectively. At 12 months, the complete response rate was comparable between the two groups (94.6% vs 90.9%, p=0.748). During a median follow-up of 66 months, recurrence-free survival was significantly longer in the ESD group than in the ERFA group (p=0.004), while no significant differences in overall survival (p=0.845) and disease-specific survival (p=0.494) were observed.Preoperative diagnosis of intramucosal cancer (adjusted hazard ratio, 5.55; vs high-grade intraepithelial neoplasia) was an independent predictor of recurrence. Significantly fewer patients in the ERFA group experienced stenosis compare to ESD group (15.2% vs 38.0%, p=0.016). Conclusions The risk of recurrence was higher for ERFA than ESD for ESCN but overall survival was not affected. The risk of esophageal stenosis was significantly lower for patients who underwent ERFA.

Background/Aims: Endoscopic radiofrequency ablation (ERFA) is a treatment option for superficial esophageal squamous cell neoplasia (ESCN), with a relatively low risk of stenosis; however, the long-term outcomes remain unclear. We aimed to compare the long-term outcomes of patients with widespread superficial ESCN who underwent endoscopic submucosal dissection (ESD) or ERFA. Methods: We retrospectively analyzed the clinical data of patients with superficial ESCN who underwent ESD or ERFA between January 2015 and December 2021. The primary outcome measure was recurrence-free survival. Results: Ninety-two and 33 patients with superficial ESCN underwent ESD and ERFA, respectively. The en bloc, R0, and curative resection rates for ESD were 100.0%, 90.2%, and 76.1%, respectively. At 12 months, the complete response rate was comparable between the two groups (94.6% vs 90.9%, p=0.748). During a median follow-up of 66 months, recurrence-free survival was significantly longer in the ESD group than in the ERFA group (p=0.004), while no significant differences in overall survival (p=0.845) and disease-specific survival (p=0.494) were observed.Preoperative diagnosis of intramucosal cancer (adjusted hazard ratio, 5.55; vs high-grade intraepithelial neoplasia) was an independent predictor of recurrence. Significantly fewer patients in the ERFA group experienced stenosis compare to ESD group (15.2% vs 38.0%, p=0.016). Conclusions The risk of recurrence was higher for ERFA than ESD for ESCN but overall survival was not affected. The risk of esophageal stenosis was significantly lower for patients who underwent ERFA.

Background/Aims: Endoscopic radiofrequency ablation (ERFA) is a treatment option for superficial esophageal squamous cell neoplasia (ESCN), with a relatively low risk of stenosis; however, the long-term outcomes remain unclear. We aimed to compare the long-term outcomes of patients with widespread superficial ESCN who underwent endoscopic submucosal dissection (ESD) or ERFA. Methods: We retrospectively analyzed the clinical data of patients with superficial ESCN who underwent ESD or ERFA between January 2015 and December 2021. The primary outcome measure was recurrence-free survival. Results: Ninety-two and 33 patients with superficial ESCN underwent ESD and ERFA, respectively. The en bloc, R0, and curative resection rates for ESD were 100.0%, 90.2%, and 76.1%, respectively. At 12 months, the complete response rate was comparable between the two groups (94.6% vs 90.9%, p=0.748). During a median follow-up of 66 months, recurrence-free survival was significantly longer in the ESD group than in the ERFA group (p=0.004), while no significant differences in overall survival (p=0.845) and disease-specific survival (p=0.494) were observed.Preoperative diagnosis of intramucosal cancer (adjusted hazard ratio, 5.55; vs high-grade intraepithelial neoplasia) was an independent predictor of recurrence. Significantly fewer patients in the ERFA group experienced stenosis compare to ESD group (15.2% vs 38.0%, p=0.016). Conclusions The risk of recurrence was higher for ERFA than ESD for ESCN but overall survival was not affected. The risk of esophageal stenosis was significantly lower for patients who underwent ERFA.

Background/Aims: Endoscopic radiofrequency ablation (ERFA) is a treatment option for superficial esophageal squamous cell neoplasia (ESCN), with a relatively low risk of stenosis; however, the long-term outcomes remain unclear. We aimed to compare the long-term outcomes of patients with widespread superficial ESCN who underwent endoscopic submucosal dissection (ESD) or ERFA. Methods: We retrospectively analyzed the clinical data of patients with superficial ESCN who underwent ESD or ERFA between January 2015 and December 2021. The primary outcome measure was recurrence-free survival. Results: Ninety-two and 33 patients with superficial ESCN underwent ESD and ERFA, respectively. The en bloc, R0, and curative resection rates for ESD were 100.0%, 90.2%, and 76.1%, respectively. At 12 months, the complete response rate was comparable between the two groups (94.6% vs 90.9%, p=0.748). During a median follow-up of 66 months, recurrence-free survival was significantly longer in the ESD group than in the ERFA group (p=0.004), while no significant differences in overall survival (p=0.845) and disease-specific survival (p=0.494) were observed.Preoperative diagnosis of intramucosal cancer (adjusted hazard ratio, 5.55; vs high-grade intraepithelial neoplasia) was an independent predictor of recurrence. Significantly fewer patients in the ERFA group experienced stenosis compare to ESD group (15.2% vs 38.0%, p=0.016). Conclusions The risk of recurrence was higher for ERFA than ESD for ESCN but overall survival was not affected. The risk of esophageal stenosis was significantly lower for patients who underwent ERFA.

OBJECTIVE: To observe the effects of moxibustion at different temperatures on cognitive function and blood glucose levels in patients with cognitive impairment associated with type 2 diabetes mellitus (T2DM). METHODS: A total of 66 T2DM patients with cognitive impairment were randomly assigned to a high-temperature group (22 cases, 1 case dropped out, 1 case was eliminated), a medium-temperature group (22 cases, 2 cases were eliminated), and a low-temperature group (22 cases, 2 cases were eliminated). All groups received moxibustion at Baihui (GV20), Dazhui (GV14), and Shenting (GV24) based on their existing glycemic control treatment. Moxibustion temperatures were maintained at 44-46 ℃ (high-temperature group), 41-43 ℃ (medium-temperature group), and 38-40 ℃ (low-temperature group), respectively, for 20 min per session, every other day, 3 times a week for 3 months. The Montreal cognitive assessment (MoCA) score, mini-mental state examination (MMSE) score, short-term memory (STM) accuracy and average reaction time, Rey-Osterrieth complex figure (ROCF) score, fasting plasma glucose (FPG), and glycated hemoglobin (HbA1c) were assessed before and after treatment. Clinical efficacy was evaluated after treatment. RESULTS: After treatment, MMSE scores in all three groups were higher than those before treatment (P<0.05). In the high-temperature group, the total MoCA score and the scores of visuospatial and executive function, memory and delayed recall, attention, naming, language, and abstraction were higher than those before treatment (P<0.05); the scores of ROCF copy, immediate recall, and delayed recall were higher than those before treatment (P<0.05); the HbA1c level was lower than that before treatment (P<0.05). In the medium-temperature group, the total MoCA score and the scores of memory and delayed recall, attention, and language were higher than those before treatment (P<0.05). STM accuracy was higher than before treatment (P<0.05), and STM average reaction time was shorter than before treatment (P<0.05) in both the high-temperature and medium-temperature groups. After treatment, the total MoCA score and the scores of visuospatial and executive function, memory and delayed recall, attention, and language in the high-temperature group were higher than those in the medium- and low-temperature groups (P<0.05); MMSE score, STM accuracy, and ROCF immediate recall and delayed recall scores were higher than those in the medium- and low-temperature groups (P<0.05); STM average reaction time was shorter than that in the medium- and low-temperature groups (P<0.05); HbA1c level was lower than that in the low-temperature group (P<0.05). The total MoCA score, attention score, and MMSE score in the medium-temperature group were higher than those in the low-temperature group (P<0.05), and STM average reaction time was shorter than that in the low-temperature group (P<0.05). There were no statistically significant differences in FPG within or between the three groups before and after treatment (P>0.05). The total effective rates were 75.0% (15/20) in the high-temperature group, 50.0% (10/20) in the medium-temperature group, and 15.0% (3/20) in the low-temperature group; the total effective rate in the high-temperature group was significantly higher than that in the low-temperature group (P<0.05). CONCLUSION Moxibustion at different temperatures has a dose-effect relationship in treating cognitive impairment in T2DM patients. A temperature range of 44-46 ℃ is more effective in improving cognitive function and stabilizing average blood glucose levels over 2-3 months.
Humans ; Diabetes Mellitus, Type 2/therapy* ; Male ; Female ; Moxibustion ; Middle Aged ; Aged ; Cognitive Dysfunction/psychology* ; Cognition ; Temperature ; Blood Glucose/metabolism* ; Adult ; Acupuncture Points

BACKGROUND: While emotional distress, encompassing anxiety and depression, has been associated with negative clinical outcomes, its impact across various clinical departments and general hospitals has been less explored. Previous studies with limited sample sizes have examined the effectiveness of specific treatments (e.g., antidepressants) rather than a systemic management strategy for outcome improvement in non-psychiatric inpatients. To enhance the understanding of the importance of addressing mental health care needs among non-psychiatric patients in general hospitals, this study retrospectively investigated the impacts of emotional distress and the effects of early detection and management of depression and anxiety on hospital length of stay (LOS) and rate of long LOS (LLOS, i.e., LOS >30 days) in a large sample of non-psychiatric inpatients. METHODS: This retrospective cohort study included 487,871 inpatients from 20 non-psychiatric departments of a general hospital. They were divided, according to whether they underwent a novel strategy to manage emotional distress which deployed the Huaxi Emotional Distress Index (HEI) for brief screening with grading psychological services (BS-GPS), into BS-GPS ( n = 178,883) and non-BS-GPS ( n = 308,988) cohorts. The LOS and rate of LLOS between the BS-GPS and non-BS-GPS cohorts and between subcohorts with and without clinically significant anxiety and/or depression (CSAD, i.e., HEI score ≥11 on admission to the hospital) in the BS-GPS cohort were compared using univariable analyses, multilevel analyses, and/or propensity score-matched analyses, respectively. RESULTS: The detection rate of CSAD in the BS-GPS cohort varied from 2.64% (95% confidence interval [CI]: 2.49%-2.81%) to 20.50% (95% CI: 19.43%-21.62%) across the 20 departments, with a average rate of 5.36%. Significant differences were observed in both the LOS and LLOS rates between the subcohorts with CSAD (12.7 days, 535/9590) and without CSAD (9.5 days, 3800/169,293) and between the BS-GPS (9.6 days, 4335/178,883) and non-BS-GPS (10.8 days, 11,483/308,988) cohorts. These differences remained significant after controlling for confounders using propensity score-matched comparisons. A multilevel analysis indicated that BS-GPS was negatively associated with both LOS and LLOS after controlling for sociodemographics and the departments of patient discharge and remained negatively associated with LLOS after controlling additionally for the year of patient discharge. CONCLUSION Emotional distress significantly prolonged the LOS and increased the LLOS of non-psychiatric inpatients across most departments and general hospitals. These impacts were moderated by the implementation of BS-GPS. Thus, BS-GPS has the potential as an effective, resource-saving strategy for enhancing mental health care and optimizing medical resources in general hospitals.
Humans ; Retrospective Studies ; Male ; Length of Stay/statistics & numerical data* ; Female ; Middle Aged ; Adult ; Psychological Distress ; Inpatients/psychology* ; Aged ; Anxiety/diagnosis* ; Depression/diagnosis*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To construct a Z-score regression model for coronary artery diameter based on echocardiographic data from children in Sichuan Province and to establish a Z-score calculation formula. METHODS: A total of 744 healthy children who underwent physical examinations at Sichuan Provincial People's Hospital from January 2020 to December 2022 were selected as the modeling group, while 251 children diagnosed with Kawasaki disease at the same hospital from January 2018 to December 2022 were selected as the validation group. Pearson correlation analysis was conducted to analyze the relationships between coronary artery diameter values and age, height, weight, and body surface area. A regression model was constructed using function transformation to identify the optimal regression model and establish the Z-score calculation formula, which was then validated. RESULTS: The Pearson correlation analysis showed that the correlation coefficients for the diameters of the left main coronary artery, left anterior descending artery, left circumflex artery, and right coronary artery with body surface area were 0.815, 0.793, 0.704, and 0.802, respectively (P<0.05). Among the constructed regression models, the power function regression model demonstrated the best performance and was therefore chosen as the optimal model for establishing the Z-score calculation formula. Based on this Z-score calculation formula, the detection rate of coronary artery lesions was found to be 21.5% (54/251), which was higher than the detection rate based on absolute values of coronary artery diameter. Notably, in the left anterior descending and left circumflex arteries, the detection rate of coronary artery lesions using this Z-score calculation formula was higher than that of previous classic Z-score calculation formulas. CONCLUSIONS The Z-score calculation formula established based on the power function regression model has a higher detection rate for coronary artery lesions, providing a strong reference for clinicians, particularly in assessing coronary artery lesions in children with Kawasaki disease.
Humans ; Male ; Female ; Child, Preschool ; Child ; Coronary Artery Disease/diagnostic imaging* ; Infant ; Mucocutaneous Lymph Node Syndrome ; Regression Analysis ; Coronary Vessels/diagnostic imaging* ; Echocardiography ; Adolescent

OBJECTIVE: To study the effects and mechanisms of juglone on the proliferation and apoptosis of acute myeloid leukemia (AML) cells. METHODS: Juglone and AML targets were collected from public databases, and the intersecting target clusters were taken for functional enrichment analysis to explore the potential mechanism of juglone in the treatment of AML. Then wet experiments were performed to verify. AML cell lines including KG-1a, MV-411, THP-1 and MOLM-13 were treated with different concentrations of juglone for 24 h. MTT assay was used to detect cell viability and determine the IC₅₀, and the most sensitive cell line was screened for subsequent experiments. Flow cytometry was used to detect the apoptosis of cells treated with different concentrations of juglone. Western blot was performed to check the expression of relevant proteins. RESULTS: Eleven targets were obtained as potential targets for juglone in the treatment of AML, and the top ten significantly enriched pathways were intrinsic pathway of apoptosis, programmed cell death, cytochrome c-mediated apoptotic response, apoptosis, apoptotic factor-mediated response, regulated necrosis, cytokine signaling in immune system, signaling by interleukins, oncogene induced senescence, and signal transduction. The cell viability of KG-1a, MV-411, THP-1 and MOLM-13 was decreased with increasing juglone concentration after 24 h of juglone treatment (r =-0.992, -0.886, -0.956, -0.910). Among them, MOLM-13 was the most sensitive to juglone. The results of flow cytometry showed that the apoptosis rate of MOLM-13 tended to significantly increase with the increasing concentration of juglone (r =0.99). At the same time point, p-RIPK1/RIPK1, p-RIPK3/RIPK3, and p-MLKL/MLK were decreased in each juglone concentration group compared with control group. CONCLUSION Juglone inhibits the viability of KG-1a, MV-411, THP-1 and MOLM-13 cells, and induces apoptosis of MOLM-13 cells, the mechanism of which may be related to the inhibition of RIPK1/RIPK3/MLKL signaling pathway.
Humans ; Naphthoquinones/pharmacology* ; Apoptosis/drug effects* ; Cell Proliferation/drug effects* ; Leukemia, Myeloid, Acute/pathology* ; Cell Line, Tumor ; Receptor-Interacting Protein Serine-Threonine Kinases/metabolism* ; Protein Kinases/metabolism* ; Signal Transduction ; Cell Survival/drug effects*

BACKGROUND: Atrial fibrillation (AF) is a common cardiac arrhythmia in the elderly. This study aimed to evaluate urban-rural disparities in its prevalence and management in elderly Chinese. METHODS: Consecutive participants aged ≥ 65 years attending outpatient clinics were enrolled for AF screening using handheld single-lead electrocardiogram (ECG) from April 2017 to December 2022. Each ECG rhythm strip was reviewed from the research team. AF or uninterpretable single-lead ECGs were referred for 12-lead ECG. Primary study outcome comparison was between rural and urban areas for the prevalence of AF. The Student's t-test was used to compare mean values of clinical characteristics between rural and urban participants, while the Pearson's chi-square test was used to compare between-group proportions. Multivariate stepwise logistic regression analysis was performed to estimate the association between AF and various patient characteristics. RESULTS: The 29,166 study participants included 13,253 men (45.4%) and had a mean age of 72.2 years. The 7073 rural participants differed significantly (P ≤ 0.02) from the 22,093 urban participants in several major characteristics, such as older age, greater body mass index, and so on. The overall prevalence of AF was 4.6% (n = 1347). AF was more prevalent in 7073 rural participants than 22,093 urban participants (5.6% vs. 4.3%, P < 0.01), before and after adjustment for age, body mass index, blood pressure, pulse rate, cigarette smoking, alcohol consumption and prior medical history. Multivariate logistic regression analysis identified overweight/obesity (OR = 1.35, 95% CI: 1.17-1.54) in urban areas and cigarette smoking (OR = 1.62, 95% CI: 1.20-2.17) and alcohol consumption (OR = 1.42, 95% CI: 1.04-1.93) in rural areas as specific risk factors for prevalent AF. In patients with known AF in urban areas (n = 781) and rural areas (n = 338), 60.6% and 45.9%, respectively, received AF treatment (P < 0.01), and only 22.4% and 17.2%, respectively, received anticoagulation therapy (P = 0.05). CONCLUSIONS In China, there are urban-rural disparities in AF in the elderly, with a higher prevalence and worse management in rural areas than urban areas. Our study findings provide insight for health policymakers to consider urban-rural disparity in the prevention and treatment of AF.