1.Analysis of the association between the use of oral progesterone drugs in early pregnancy and gestational diabetes mellitus
Yan QIN ; Jinhua GU ; Jing ZHU ; Lin LUO ; Peng PING ; Lingqi GU
China Pharmacy 2025;36(6):721-726
OBJECTIVE To explore the association between the use of oral progesterone drugs in early pregnancy and gestational diabetes mellitus (GDM). METHODS Through real-world retrospective cohort research method, pregnant women who underwent the oral glucose tolerance test (OGTT) at the Affiliated Maternal and Child Health Hospital of Nantong University between January 2022 and January 2023 were enrolled. Based on whether oral progesterone drugs were used in early pregnancy, they were divided into treatment group and control group; propensity score matching (PSM) with a 1∶1 ratio was employed to control for confounding factors; Logistic regression and linear regression were employed to analyze the association between drug factors (whether use of oral progesterone drug, duration of medication, dosage, and drug type) and outcome indicators (occurrence of GDM, fasting blood glucose levels, and OGTT 1 and 2 h blood glucose levels in late pregnancy). RESULTS A total of 709 pregnant women were enrolled in the two groups before PSM; after PSM, 256 cases were included in both the treatment group and the control group. The results of association analysis indicated that there was no significant association between the use of oral progesterone drugs and GDM (P>0.05); but a significant correlation was found with OGTT 1 h blood glucose levels [β=0.965, 95%CI (0.007,1.922), P<0.05], specifically with Dydrogesterone tablets [β=0.977, 95%CI (0.009, 1.944), P<0.05] and Progesterone soft capsules [β =1.089, 95%CI (0.077, 2.102), P<0.05]. There was no significant correlation between other drug factors and outcome indicators (P>0.05). CONCLUSIONS The use of oral progestogen drugs in early pregnancy is not significantly associated with GDM. The blood glucose levels in late pregnancy, especially OGTT 1 h blood glucose levels, have a certain correlation with Progesterone soft capsules and Dydrogesterone tablets.
2.An assessment model for efficacy of autologous CD19 chimeric antigen receptor T-cell therapy and relapse or refractory diffuse large B-cell lymphoma risk.
Bin XUE ; Yifan LIU ; Min ZHANG ; Gangfeng XIAO ; Xiu LUO ; Lili ZHOU ; Shiguang YE ; Yan LU ; Wenbin QIAN ; Li WANG ; Ping LI ; Aibin LIANG
Chinese Medical Journal 2025;138(1):108-110
3.Identification and expression analysis of seed dehydration tolerance and PLD gene family in Panax medicinal plants.
Chao-Lin LI ; Min HUANG ; Na GE ; Qing-Yan WANG ; Jin-Shan JIA ; Ting LUO ; Jin-Yan ZHANG ; Ping ZHOU ; Jun-Wen CHEN
China Journal of Chinese Materia Medica 2025;50(12):3307-3321
Panax species are mostly valuable medicinal plants. While some species' seeds are sensitive to dehydration, the dehydration tolerance of seeds from other Panax species remains unclear. The phospholipase D(PLD) gene plays an important role in plant responses to dehydration stress. However, the characteristics of the PLD gene family and their mechanisms of response to dehydration stress in seeds of Panax species with different dehydration tolerances are not well understood. This study used seeds from eight Panax species to measure the germination rates and PLD activity after dehydration and to analyze the correlation between dehydration tolerance and seed traits. Bioinformatics analysis was also conducted to characterize the PnPLD and PvPLD gene families and to evaluate their expression patterns under dehydration stress. The dehydration tolerance of Panax seeds was ranked from high to low as follows: P. ginseng, P. zingiberensis, P. quinquefolius, P. vietnamensis var. fuscidiscus, P. japonicus var. angustifolius, P. japonicus, P. notoginseng, and P. stipuleanatus. A significant negative correlation was found between dehydration tolerance and seed shape(three-dimensional variance), with flatter seeds exhibiting stronger dehydration tolerance(r=-0.792). Eighteen and nineteen PLD members were identified in P. notoginseng and P. vietnamensis var. fuscidiscus, respectively. These members were classified into five isoforms: α, β, γ, δ, and ζ. The gene structures, subcellular localization, physicochemical properties, and other characteristics of PnPLD and PvPLD were similar. Both promoters contained regulatory elements associated with plant growth and development, hormone responses, and both abiotic and biotic stress. During dehydration, the PLD enzyme activity in P. notoginseng seeds gradually increased as the water content decreased, whereas in P. vietnamensis var. fuscidiscus, PLD activity first decreased and then increased. The expression of PLDα and PLDδ in P. notoginseng seeds initially increased and then decreased, whereas in P. vietnamensis var. fuscidiscus, the expression of PLDα and PLDδ consistently decreased. In conclusion, the dehydration tolerance of Panax seeds showed a significant negative correlation with seed shape. The dehydration tolerance in P. vietnamensis var. fuscidiscus and dehydration sensitivity of P. notoginseng seeds may be related to differences in PLD enzyme activity and the expression of PLDα and PLDδ genes. This study provided the first systematic comparison of dehydration tolerance in Panax seeds and analyzed the causes of tolerance differences and the optimal water content for long-term storage at ultra-low temperatures, thus providing a theoretical basis for the short-term and ultra-low temperature long-term storage of medicinal plant seeds with varying dehydration tolerances.
Seeds/metabolism*
;
Panax/physiology*
;
Plant Proteins/metabolism*
;
Gene Expression Regulation, Plant
;
Phospholipase D/metabolism*
;
Plants, Medicinal/enzymology*
;
Germination
;
Multigene Family
;
Water/metabolism*
;
Dehydration
;
Phylogeny
4.Progress in investigating astrocyte heterogeneity after spinal cord injury based on single-cell sequencing technology.
Lei DU ; Yan-Jun ZHANG ; Tie-Feng GUO ; Lin-Zhao LUO ; Ping-Yi MA ; Jia-Ming LI ; Sheng TAN
China Journal of Orthopaedics and Traumatology 2025;38(5):544-548
In recent years, the study of single-cell transcriptome sequencing technology in the heterogeneity of astrocytes (astrocytes) after spinal cord injury (SCI) has provided new perspectives on post-traumatic nerve regeneration and repair. To provide a review on the research progress of single-cell sequencing technology in astrocytes after spinal cord injury (SCI), and to more comprehensively and deeply elaborate the application of single-cell sequencing technology in the field of astrocytes after SCI. Single-cell sequencing technology can analyse the transcriptomes of individual cells in a high-throughput manner, thus revealing fine differences in cell types and states. By using single-cell sequencing technology, the heterogeneity of astrocytes after SCI and their association with nerve regeneration and repair were revealed. In conclusion, the application of single-cell sequencing technology provides an important tool to reveal the heterogeneity of astrocytes after SCI, to further explore the mechanisms of astrocytes in SCI, and to develop intervention strategies targeting their regulatory mechanisms in order to improve the therapeutic efficacy of SCI. The discovery of changes in astrocyte transcriptome dynamics has improved researchers' understanding of spinal cord injury lesion progression and provided new insights into the treatment of spinal cord injury at different time points. To date, all of these findings need to be validated by more basic research and sufficient clinical trials. In the future, single-cell sequencing technology, through interdisciplinary collaboration with bioinformatics, computer science, tissue engineering, and clinical medicine, is expected to open a new window for the treatment of spinal cord injury.
Spinal Cord Injuries/metabolism*
;
Astrocytes/cytology*
;
Single-Cell Analysis/methods*
;
Humans
;
Animals
;
Transcriptome
;
Nerve Regeneration
5.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
6.Graph Neural Networks and Multimodal DTI Features for Schizophrenia Classification: Insights from Brain Network Analysis and Gene Expression.
Jingjing GAO ; Heping TANG ; Zhengning WANG ; Yanling LI ; Na LUO ; Ming SONG ; Sangma XIE ; Weiyang SHI ; Hao YAN ; Lin LU ; Jun YAN ; Peng LI ; Yuqing SONG ; Jun CHEN ; Yunchun CHEN ; Huaning WANG ; Wenming LIU ; Zhigang LI ; Hua GUO ; Ping WAN ; Luxian LV ; Yongfeng YANG ; Huiling WANG ; Hongxing ZHANG ; Huawang WU ; Yuping NING ; Dai ZHANG ; Tianzi JIANG
Neuroscience Bulletin 2025;41(6):933-950
Schizophrenia (SZ) stands as a severe psychiatric disorder. This study applied diffusion tensor imaging (DTI) data in conjunction with graph neural networks to distinguish SZ patients from normal controls (NCs) and showcases the superior performance of a graph neural network integrating combined fractional anisotropy and fiber number brain network features, achieving an accuracy of 73.79% in distinguishing SZ patients from NCs. Beyond mere discrimination, our study delved deeper into the advantages of utilizing white matter brain network features for identifying SZ patients through interpretable model analysis and gene expression analysis. These analyses uncovered intricate interrelationships between brain imaging markers and genetic biomarkers, providing novel insights into the neuropathological basis of SZ. In summary, our findings underscore the potential of graph neural networks applied to multimodal DTI data for enhancing SZ detection through an integrated analysis of neuroimaging and genetic features.
Humans
;
Schizophrenia/pathology*
;
Diffusion Tensor Imaging/methods*
;
Male
;
Female
;
Adult
;
Brain/metabolism*
;
Young Adult
;
Middle Aged
;
White Matter/pathology*
;
Gene Expression
;
Nerve Net/diagnostic imaging*
;
Graph Neural Networks
7.Efficacy and mechanisms of an Angelica sinensis Cistanche Fiber Compound for constipation relief
Yang LIU ; Ya-li SHI ; Yan-ping WU ; Xiang LUO ; Lei LIANG ; Rong-rong HE
Acta Pharmaceutica Sinica 2024;59(5):1238-1244
Constipation is a prevalent ailment which might significantly impact the quality of people's life and rise some associated deseases risks. In this study, a chronic constipation mouse model was established using loperamide hydrochloride. Mice were gavaged an
8.The Role of Nrf2 in Exercise Improving of NAFLD
Ge ZHAO ; Yuan LUO ; Ya-Ping LI ; Yan-Qing YAN ; Shu-Jing LIU
Progress in Biochemistry and Biophysics 2024;51(5):1079-1089
In cardiovascular disorders, neurological diseases, and chronic metabolic diseases, the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway is essential for maintaining cell homeostasis. According to studies, boosting Nrf2 expression can be used to cure or prevent chronic diseases that are characterized by oxidative stress, inflammation, and mitochondrial dysfunction. Nonalcoholic fatty liver disease (NAFLD) is a chronic metabolic liver disease characterized by hepatic steatosis brought on by a number of causes other than alcohol. In recent years, its incidence has gradually risen across the globe. According to relevant studies, NAFLD and the Nrf2 signaling pathway are tightly connected. Inhibiting lipid production and metabolism-related enzymes, repairing impaired liver metabolism, and lowering hepatic lipid storage are all possible with Nrf2 activation. Exercise is a powerful tool for treating and preventing NAFLD. However, exercise type, exercise intensity, environment, and exhaustion all have an impact on the Nrf2 signaling pathway. By activating Nrf2, exercise can lessen liver inflammation, oxidative stress, endoplasmic reticulum stress, and insulin resistance, and ameliorate liver damage to improve NAFLD. The activation of Nrf2 signaling pathway, its associated mechanism of controlling antioxidation, and the impact of exercise on the Nrf2 signaling pathway are all explained in this work. Based on the pathogenesis of NAFLD, this article examines the connection between exercise, Nrf2, and NAFLD, and the current state of knowledge regarding Nrf2’s role in the amelioration of NAFLD through exercise. It offers a theoretical frame of reference for future research into how Nrf2 might be used to improve NAFLD.
9.A multi-dimensional analysis of pollen broadcasting concerns in Chinese population: a large-scale multi-center cross-sectional survey
Chiyu XU ; Yanshu ZHANG ; Ning LUAN ; Xiangyi LIU ; Dayang QIN ; Hongmin WANG ; Xuping XIAO ; Shuihong ZHOU ; Jie ZHANG ; Ping ZHANG ; Yuqing BAI ; Pengpeng WANG ; Yan QI ; Zhongwu SUN ; Zhuang LIU ; Luo BA ; Wenchao WANG ; Xing LU ; Min WANG ; Rui GUO ; Deyi SUN ; Liyuan TAO ; Li ZHU
Chinese Journal of Otorhinolaryngology Head and Neck Surgery 2024;59(1):2-11
Objective:To investigate the concern about pollen broadcasting in Chinese population from multiple dimensions and to understand the information about allergic rhinitis (AR) in China by analyzing related factors.Methods:From March 1 to September 30, 2022, a large-scale multi-center cross-sectional survey was conducted based on the Questionnaire Star platform in 21 Chinese hospitals. A total of 7 056 subjects from 7 regions in China: Northeast, North, East, Central, South, Southwest, and Northwest China were included. Basic characteristics (including social demographic characteristics and disease characteristics of AR patients), concern about pollen broadcasting, the willingness of pollen-induced AR (PiAR) patients to receive pollen broadcasting, and the treatment satisfaction rate of AR patients were collected. The chi-square test, multivariate linear regression model, and Logistic regression analysis were used to analyze the concern about pollen broadcasting in the Chinese population and related factors from multiple dimensions.Results:Among 7 056 subjects, 23.02% were concerned about pollen broadcasting. Among 3 176 self-reported AR and 1 019 PiAR patients, 25.60% and 39.16% were concerned about pollen broadcasting, respectively, which was higher than that of non-AR or non-PiAR subjects ( χ2 value was 21.74 and 175.11, respectively, both P<0.001). Among AR patients, the proportion of spring and autumn allergen-positive patients concerned about pollen broadcasting was higher than that in perennial allergen-positive patients ( χ2 value was 20.90 and 19.51, respectively, both P<0.001). The proportion of AR patients with asthma, sinusitis, allergic conjunctivitis, and cardiovascular and cerebrovascular diseases was higher than those without complications ( χ2 value was 50.83, 21.97, 56.78, 7.62, respectively, all P<0.05). The proportion of AR patients in North China who could find pollen broadcasting locally was 31.01%, significantly higher than those in other regions (all P<0.05). Multivariate linear regression model analysis showed that among PiAR patients, those with higher per capita household income and higher AR disease cognition levels had been concerned about pollen broadcasting in the past, and those complicated with allergic conjunctivitis had stronger intention to receive pollen broadcasting (B value was 0.24, 0.13, 0.66, 0.47, respectively, all P<0.05). The higher the disease cognition level of PiAR patients, the stronger their willingness to actively participate in treatment ( R2=0.72, P<0.001). Only 18.89% of AR patients felt satisfied with the treatment effect. Logistic regression analysis showed that in AR patients, the treatment satisfaction rate was significantly higher among those concerned about pollen broadcasting compared to those who were not ( OR=1.83, P<0.001). Conclusions:Currently, the dissemination of pollen broadcasting in China is hindered by various factors such as disease cognition level. The treatment satisfaction among AR patients remains unsatisfactory.
10.Metabonomic study of blood of mice with high-voltage electrical injury
Si-Yu CHEN ; Hui WANG ; Yan LUO ; Jia-Wen TAO ; Wen-Juan ZHANG ; Yang YUE ; Zheng-Ping YU ; Hui-Feng PI
Journal of Regional Anatomy and Operative Surgery 2024;33(2):100-106
Objective To explore the changes of metabonomics in blood of mice after high-voltage electric shock,then screen out the significantly changed differential metabolites and metabolic pathways.Methods The head of C57BL/6J mice was subjected to high-voltage electric shock(electric shock group)or exposed to acoustic and optical stimulation of high-voltage electric(control group),then the whole blood from mice were collected to separate serum.The dual platform combined metabonomic analysis based on gas chromatography-mass spectrometer(GC-MS)and liquid chromatography-mass spectrometer(LC-MS)was performed and orthogonal partial least squares discriminant analysis(OPLS-DA)was used to screen the differential metabolites and related metabolic pathways.Results A total of 415 differential metabolites were screened out in metabonomics in blood of mice after high-voltage electric shock,including 187 up-regulated and 228 down-regulated metabolites.These differentially metabolites were significantly enriched in metabolic pathways including central carbon metabolism in cancer,glucagon signaling pathway,etc.Conclusion By establishing the model of high-voltage electrical injury on experimental mice,this study reveals the significant change of metabolite content and metabolic pathway in blood by high-voltage electrical injury.Which provides a basis for the damage of blood metabolic activity by high-voltage electrical injury,and suggests the potential harm of high-voltage electrical injury to blood metabolic activity in the whole body.

Result Analysis
Print
Save
E-mail