[Objective] To explore the relationship between neutrophil activation under cardiopulmonary bypass (CPB) and the incidence of cardiac surgery-associated acute kidney injury (CS-AKI). [Methods] This prospective cohort study enrolled adult patients who scheduled for cardiac surgery under CPB at West China Hospital between May 1, 2022 and March 31, 2023. The primary outcome was acute kidney injury (AKI). Blood samples (5 mL) were obtained from the central vein before surgery, at rewarming, at the end of CPB, and 24 hours after surgery. Neutrophils were labeled with CD11b, CD54 and other markers. To assess the effect of neutrophils activation on AKI, propensity score matching (PSM) was employed to equilibrate covariates between the groups. [Results] A total of 120 patients included into the study, and 17 (14.2%) developed AKI. Both CD11b⁺ and CD54⁺ neutrophils significantly increased during the rewarming phase and the increases were kept until 24 hours after surgery. During rewarming, the numbers of CD11b⁺ neutrophils were significantly higher in AKI compared to non-AKI (4.71×10⁹/L vs 3.31×10⁹/L, Z=-2.14, P<0.05). Similarly, the CD54⁺ neutrophils counts were also significantly higher in AKI than in non-AKI before surgery (2.75×10⁹/L vs 1.79×10⁹/L, Z=-2.99, P<0.05), during rewarming (3.12×10⁹/L vs 1.62×10⁹/L, Z=-4.34, P<0.05), and at the end of CPB (4.28×10⁹/L vs 2.14×10⁹/L, Z=-3.91, P<0.05). An analysis of 32 matched patients (16 in each group) revealed that CD11b⁺ and CD54⁺ neutrophil levels of AKI were 1.74 folds (4.83×10⁹/L vs 2.77×10⁹/L, Z=-2.72, P<0.05) and 2.34 folds (3.32×10⁹/L vs 1.42×10⁹/L, Z=-4.12, P<0.05), respectively, of non-AKI at rewarming phase. [Conclusion] Neutrophils are activated during CPB, and they can be identified by CD11b/CD54 markers. The activated neutrophils of AKI patients are approximately 2 folds of non-AKI during the rewarming phase, with disparity reached peak between groups during rewarming. These findings suggest the removal of 50% of activated neutrophils during the rewarming phase may be effective to reduce the risk of AKI.

BACKGROUND: Most studies have evaluated disability-adjusted life years (DALYs) of colorectal cancer (CRC) patients based on a set of generic disability weights (DWs). This study aimed to apply local CRC-stage-specific DWs to estimate the burden of DALYs for CRC (CRC-DALYs) in populations in China and consider the influence of local screening coverage of CRC. METHODS: A prevalence-based model was constructed using data from various sources. Years lived with disability (YLDs) were estimated mainly via cumulative prevalence data (based on CRC incidence rates, population numbers, and survival rates), stage-specific proportions of CRC, and DWs of the local population. Years of life lost (YLLs) were calculated based on the CRC mortality rates and standard life expectancies. CRC incidence and mortality rates for the years 2020, 2025, and 2030 were estimated by joinpoint regression, and the corresponding DALYs were predicted. The main assumption was made for CRC screening coverage. Sensitivity analyses were used to assess the impact of population, DWs, and coverage. RESULTS: In 2017, among the Chinese population, the estimated number of CRC-DALYs was 4,303,314 (11.9% for YLDs). If CRC screening coverage rate in China (2.3%) remains unchanged, the overall DALYs in 2030 are predicted to increase by 37.2% (45.1% of those aged ≥65 years). More optimistically, the DALYs would then decrease by 0.7% in 2030 (from 5,902,454 to 5,860,200) if the coverage could be increased to 25.0%. A sensitivity analysis revealed that using local DWs would change the base-case values by 5.7%. CONCLUSIONS The estimated CRC-DALYs in China using population-specific DWs were considerably lower (with a higher percentage of YLDs) than the global burden of disease (GBD) estimates (5,865,004, of 4.6% for YLDs), suggesting the impact extent of applying local parameters. Sustainable scale-up CRC screening needs to be in place to moderate the growth trend of CRC-DALYs in China.
Humans ; Colorectal Neoplasms/diagnosis* ; China/epidemiology* ; Disability-Adjusted Life Years ; Male ; Prevalence ; Female ; Middle Aged ; Aged ; Early Detection of Cancer ; Quality-Adjusted Life Years ; Adult ; Incidence

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To explore the preventive and therapeutic effects of Dahuang Zhechong Pill (DZP) on pulmonary fibrosis and the underlying mechanisms. METHODS: The first key rate-limiting enzyme hexokinase 2 (HK2) of glycolysis was silenced and over-expressed through small interfering RNA and lentivirus using lung fibroblast MRC-5 cell line, respectively. The cell viability, migration, invasion and proliferation were detected by cell counting kit-8, wound healing assay, transwell assay, and flow cytometry. The mRNA and protein expression levels of HK2 were detected by RT-PCR and Western blotting, respectively. The contents of glucose, adenosine triphosphate (ATP) and lactate in MRC-5 cells were determined by enzyme-linked immunosorbnent assay (ELISA). Then, the relationship between miR-29b-2-5p and HK2 was explored by luciferase reporter gene assay. Pulmonary fibrosis cell model was induced by transforming growth factor-β 1 (TGF-β 1) in MRC-5 cells, and the medicated serum of DZP (DMS) was prepared in rats. MRC-5 cells were divided into control, TGF-β 1, TGF-β 1+10% DMS, TGF-β 1+10% DMS+miR-29b-2-5p inhibitor, TGF-β 1+10% DMS+inhibitor negative control, TGF-β 1+10% DMS+miR-29b-2-5p mimic and TGF-β 1+10% DMS+mimic negative control groups. After miR-29b-2-5p mimics and inhibitors were transfected into MRC-5 cells, all groups except control and model group were treated with DMS. The effect of DMS on MRC-5 cells were detected using aforementioned methods and immunofluorescence. Similarly, the contents of glucose, ATP and lactate in each group were measured by ELISA. RESULTS: The mRNA and protein expressions of HK2 in MRC-5 cells were successfully silenced and overexpressed through si-HK2-3 and lentiviral transfection, respectively. After silencing HK2, the mRNA and protein expressions of HK2 were significantly decreased (P<0.01), and the concentrations of glucose, ATP and lactate were also significantly decreased (P<0.05). The proliferation, migration and invasion of MRC-5 cells were significantly declined (P<0.05 or P<0.01), while the apoptosis of MRC-5 cells was significantly increased (P<0.01). After overexpressing HK2, the mRNA and protein expressions of HK2 were significantly increased (P<0.05), and the concentrations of glucose, ATP and lactate were also significantly increased (P<0.05 or P<0.01). The proliferation, migration and invasion of MRC-5 cells were significantly increased (P<0.05 or P<0.01), while the apoptosis of MRC-5 cells was significantly decreased (P<0.05). The relative luciferase activity of 3'UTR-WT+hsa-miR-29b-2-5p transfected with HK2 was significantly decreased (P<0.01). After miR-29b-2-5p mimic and inhibitor were transfected into the MRC-5 cells, DMS intervention could significantly reduce the concentration of glucose, ATP and lactate, and the mRNA and proteins expressions of HK2, phosphofructokinase and pyruvate kinase isoform M2 (P<0.05 or P<0.01). The proliferation, migration and invasion of MRC-5 cells were alleviated (P<0.05 or P<0.01), and the deposition of fibronectin, α-smooth muscle actin, and collagen I were significantly decreased (P<0.05 or P<0.01). CONCLUSIONS Glycolysis is closely related to pulmonary fibrosis. DZP reduced glycolysis and inhibited fibroblasts' excessive differentiation and abnormal collagen deposition through the miR-29b-2-5p/HK2 pathway, which played a role in delaying the process of pulmonary fibrosis.
MicroRNAs/genetics* ; Glycolysis/genetics* ; Animals ; Pulmonary Fibrosis/metabolism* ; Humans ; Drugs, Chinese Herbal/therapeutic use* ; Hexokinase/genetics* ; Cell Line ; Cell Proliferation/drug effects* ; Rats, Sprague-Dawley ; Rats ; Cell Movement/drug effects* ; Male ; Cell Survival/drug effects* ; Signal Transduction/drug effects*

Objective To discuss the application of mind map in self-management of elderly patients after receiving mitral valve transcatheter edge-to-edge repair(M-TEER).Methods A total of 66 patients,who underwent M-TEER at Nanjing Hospital of Nanjing Medical University from August 2021 to October 2022,were enrolled in this study.Using the envelope concealment method,a total of 66 data analysis samples were included in the analysis.There were 33 patients each in the study group and control group.Routine health education was adopted for the patients of the control group,while the responsible nurse conducted health education for the patients of the study group under the guidance of the mind map that was designed by a multidisciplinary specialized nurses.Results There was a significant difference in postoperative medication compliance between the study group and the control group(P＜0.05),i.e.the degree of compliance,including taking medicine on time,insisting on taking medicine and taking medicine as prescribed,in the study group was obviously higher than that in the control group.The postoperative 6-min walking test,which was regarded as one of the indicators of cardiac functions,in the study group was remarkably better than that in the control group,the difference was statistically significant(P＜0.05).The postoperative quality of life(including daily activity ability,frailty degree,social support,and incidence of hospitalization for heart failure within one year after treatment)in the study group was strikingly better than that in the control group(P＜0.05).Conclusion The use of mind map in self-management of elderly patients after receiving M-TEER can effectively improve the medication compliance of the patients after discharge,improve the quality of life of patients,and reduce the incidence of hospitalization due to heart failure.

Objective To investigate the molecular mechanism of Brusatol(BRU)regulating apoptosis of Hela cells through TLR9-MyD88 signaling pathway.Methods Hela cells preserved in our laboratory were treated with Brucea javanica at different concentrations(0,5.0,10.0,20.0,40.0,80.0 nmol·L-1).Hela cells were divided into Control group(normal cultured Hela cells),BRU-L group(treated with 10.0 nmol·L-1 Brucea javanica)and BRU group-H(treated with 20.0 nmol·L-1 Brucea javanica)Cells were treated with nmol·L-1 of Brucea javanica),BRU+pcDNA-NC group(transfected with pcDNA-NC+20.0 nmol·L-1 of Brucea javanica),BRU-H+pcDNA-TLR9 group(transfected with pcDNA-TLR9+20.0 nmol·L-1 of Brucea javanica).Cell proliferation was detected by CCK-8 and EdU methods.Apoptosis was detected by TUNNEL staining and flow cytometry.The protein expression levels of TLR9,MyD88,Bax,Bcl-2,Cleaved Caspase-3 and Cleaved Caspase-9 were detected by Western blot.Cell apoptosis and mitochondrial membrane potential detection kit(JC-1)were detected by flow cytometry,and the contents of adenosine triphosphate(ATP)and reactive oxygen species(ROS)were detected by ELISA.Results Compared with 0 nmol·L-1 group,the survival rate and IC50 value of 10 nmol·L-1 group were significantly decreased(P<0.05).After stimulation of BRU with different concentrations,the proliferation ability of cells was significantly decreased in a dose-dependent manner(P<0.05).Compared with control group,the 5-ethynyl-2'-deoxyuracil(EDU)positive cell rate,TUNEL positive cell rate,apoptosis rate and Bcl-2 protein of cells in BRU-L,BRU-H and pcDNA-NC groups were significantly decreased.The protein levels of TLR9 and MyD88,Bax,Bax/Bcl-2,Cleaved Caspase-3 and Cleaved Caspase-9 were significantly increased(P<0.05).In control group,BRU-L,BRU-H group/BRU-H+pcDNA-NC,there was a continuous decreasing trend(P<0.05).Compared with the BRU-H+pcDNA-NC group,the EDU positive cell rate,TUNEL positive cell rate,apoptosis rate and Bcl-2 protein in the BRU-H+pcDNA-TLR9 group were significantly increased.The protein levels of TLR9 and MyD88,Bax,Bax/Bcl-2,Cleaved Caspase-3 and Cleaved Caspase-9 were significantly decreased(P<0.05).Compared with Control group,JC-1 level and ATP content in BRU-L,BRU-H and BRU-H+pcDNA-NC groups were significantly decreased,while ROC content and mitotracker positive cell level were significantly increased(P<0.05).Compared with BRU-L group,JC-1 level and ATP content in BRU-H group and BRU-H+pcDNA-NC group were further decreased,while ROC content and mitotracker positive cell level were further increased(P<0.05).Compared with the BRU-H+pcDNA-NC group,the levels of JC-1 and ATP in the BRU-H+pcDNA-TLR9 group were increased,while the levels of ROC,mitotracker staining positive cells were decreased(P<0.05).Conclusion Brucea javanica can produce Hela cell proliferation by regulating TLR9-MyD88 signaling pathway.

Deep vein thrombosis(DVT)is a common peripheral vascular disease in clinical practice.The lack of precise and efficient early diagnostic techniques renders it susceptible to being overlooked or misdiagnosed,and therefore,identifying trustworthy biomarkers is a major issue that has to be resolved.In this study,the endogenous metabolites in the urine of DVT rats were screened by metabolomics technology based on gas chromatograph-mass spectrometry(GC-MS)and the characteristic metabolites were identified by multiple feature selection algorithms and multivariate statistical analysis,for the development of a machine learning-based diagnostic model for DVT.The urine samples in metabolic cage in the thrombus development phase(between 48 and 72 h)of rats were collected,which was used as the models for inferior vena cava ligation.The metabolic profiles of the control group and DVT were obtained using the GC-MS method.A total of 176 kinds of endogenous metabolites were identified in rat urine through comparison with the FiehnLib database,26 kinds of differential metabolites associated with DVT were screened through a combination of the Mann-Whitney U test and orthogonal partial least squares discriminant analysis(OPLS-DA),and 13 kinds of significant metabolites strongly correlated with DVT were further evaluated in conjunction with various machine learning feature selection techniques.For DVT diagnosis,machine learning models such as Gaussian Naive Bayes(GNB),support vector machine(SVM),logistic regression(LR),and linear discriminant analysis(LDA)were developed.The diagnostic model constructed using 13 kinds of key metabolites demonstrated excellent accuracy and stability,and surpassed the predictive performance of the models utilizing 176 kinds of metabolites and 26 kinds of differential metabolites,as evidenced by examination and comparison of each model's efficacy.The study showed that the integration of multiple feature selection algorithms for analyzing metabolite information in DVT rat urine was capable of effectively identifying reliable potential markers of DVT.Furthermore,the developed machine learning model offered a novel technical approach for the automated diagnosis of DVT.

Objective To detect the expression changes of interleukin-10(IL-10)and transforming growth factor-β1(TGF-β1)during the development of deep vein thrombosis in mice,and to explore the application value of them in thrombus age estimation.Methods The mice in the experimental group were subjected to ligation of inferior vena cava.The mice were sacrificed by excessive anesthesia at 1 d,3 d,5 d,7 d,10 d,14 d and 21 d after ligation,respectively.The inferior vena cava segment with thrombosis was extracted below the ligation point.The mice in the control group were not ligated,and the inferior vena cava segment at the same position as the experimental group was extracted.The ex-pression changes of IL-10 and TGF-β1 were detected by immunohistochemistry(IHC),Western blot-ting and real-time qPCR.Results IHC results revealed that IL-10 was mainly expressed in monocytes in thrombosis and TGF-β1 was mainly expressed in monocytes and fibroblast-like cells in thrombosis.Western blotting and real-time qPCR showed that the relative expression levels of IL-10 and TGF-β1 in each experimental group were higher than those in the control group.The mRNA and protein levels of IL-10 reached the peak at 7 d and 10 d after ligation,respectively.The mRNA expression level at 7 d after ligation was 4.72±0.15 times that of the control group,and the protein expression level at 10 d after ligation was 7.15±0.28 times that of the control group.The mRNA and protein levels of TGF-β1 reached the peak at 10 d and 14 d after ligation,respectively.The mRNA expression level at 10 d after ligation was 2.58±0.14 times that of the control group,and the protein expression level at 14 d after ligation was 4.34±0.19 times that of the control group.Conclusion The expressions of IL-10 and TGF-β1 during the evolution of deep vein thrombosis present time-dependent sequential changes,and the expression levels of IL-10 and TGF-β1 can provide a reference basis for thrombus age estimation.

Objective:To investigate the effect of genetic polymorphism of MTHFR C677T (rs1801133) on methotrexate (MTX) related toxicity in pediatric mature B-cell lymphoma patients. Methods:Fifty-eight intermediate and high risk patients under 18 years of age with mature B-cell lymphoma who received 5 g/m2 MTX (24 h intravenous infusion) in Sun Yat-sen University Cancer Center from August 2014 to December 2021 were included,and their toxicity of high-dose MTX (HD-MTX) were monitored and analyzed. Results:Among the 58 pediatric patients,the number of CC,CT,and TT genotypes for MTHFR C677T was 33,19 and 6,respectively. A total of 101 courses of HD-MTX therapy were counted,of which plasma MTX level>0.2 μmol/L at 48 h post-MTX infusion were observed in 35 courses,≤0.2 μmol/L in 66 courses. Inter-group comparison showed that plasma MTX level>0.2 μmol/L at 48 h post-MTX infusion increased the risk of developing oral mucositis (P<0.05). Compared with wild-type (CC genotype),patients in the mutant group (CT+TT genotype) were more likely to develop myelosuppression,manifested as anemia,leucopenia,neutropenia and thrombocytopenia. However,plasma MTX level at 48 h was not associated with MTHFR C677T gene polymorphism. Conclusion:The risk of developing oral mucositis in children with mature B-cell lymphoma is associated with plasma MTX concentration. Polymorphism of MTHFR C677T gene is not related to plasma MTX concentration in children with mature B-cell lymphoma,but is related to grade Ⅲ to Ⅳ hematological toxicity.