To elucidate the mechanism by which steaming affects the quality of Curcuma kwangsiensis root tubers, methods such as LSCM, RVA, dual-wavelength spectrophotometry, LF-NMR, and LC-MS were employed to qualitatively and quantitatively detect changes in starch gelatinization characteristics, water distribution, and material composition of C. kwangsiensis root tubers under different steaming durations. Based on multivariate statistical analysis, the correlation between differences in gelatinization parameters, water distribution, and terpenoid material composition was investigated. The results indicate that steaming affects both starch gelatinization and water distribution in C. kwangsiensis. During the steaming process, transformations occur between amylose and amylopectin, as well as between semi-bound water and free water. After 60 min of steaming, starch gelatinization and water distribution reached an equilibrium state. The content of amylopectin, the amylose-to-amylopectin ratio, and parameters such as gelatinization temperature, viscosity, breakdown value, and setback value were significantly correlated(P≤0.05). Additionally, the amylose-to-amylopectin ratio was significantly correlated with total free water and total water content(P≤0.05). Steaming induced differences in the material composition of C. kwangsiensis root tubers. Clustering of primary metabolites in the OPLS-DA model was distinct, while secondary metabolites were classified into 9 clusters using the K-means clustering algorithm. Differential terpenoid metabolites such as(-)-α-curcumene were significantly correlated with zerumbone, retinal, and all-trans-retinoic acid(P<0.05). Curcumenol was significantly correlated with isoalantolactone and ursolic acid(P<0.05), while all-trans-retinoic acid was significantly correlated with both zerumbone and retinal(P<0.05). Alpha-tocotrienol exhibited a significant correlation with retinal and all-trans-retinoic acid(P<0.05). Amylose was extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and α-tocotrienol(P<0.05). Amylopectin was significantly correlated with zerumbone(P<0.05) and extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and 9-cis-retinoic acid(P<0.01). The results provide scientific evidence for elucidating the mechanism of quality formation of steamed C. kwangsiensis root tubers as a medicinal material.
Curcuma/chemistry* ; Starch/chemistry* ; Multivariate Analysis ; Water/chemistry* ; Terpenes/analysis* ; Plant Roots/chemistry* ; Plant Tubers/chemistry* ; Drugs, Chinese Herbal/chemistry*

OBJECTIVE: To determine risk factors for cutout failure in geriatric intertrochanteric fracture patients after cephalomedullary nail fixation. METHODS: A retrospective review of 518 elderly patients who underwent cephalomedullary nail fixation for intertrochanteric fractures between January 2008 and August 2018 was conducted, including 167 males and 351 females, age from 65 to 97 years old. All patients were followed up for at least one year after surgery and divided into a healed group and a cutout group based on whether the hip screw cutout occurred. Among all patients, 10 cases experienced hip screw cutout. The general information, surgical data, and radiological data of the two groups were compared, and risk factors influencing hip screw cutout were analyzed. Propensity score matching was then performed on the cutout group based on gender, age, body mass index(BMI), and American Society of Anesthesiologists(ASA), and 40 patients from the healed group were matched at a ratio of 1∶4. Key risk factors affecting hip screw cutout were further analyzed. Multivariable logistic regression analysis was conducted to evaluate associations between variables and cutout failure. RESULTS: There were no statistically significant differences between the healed group and the cutout group in terms of age, gender, BMI, ASA, and AO classification. However, statistically significant differences were observed between the two groups in terms of reduction quality(P=0.003) and tip-apex distance(TAD), P<0.001. Multivariate analysis identified poor reduction quality OR=23.138, 95%CI(2.163, 247.551), P=0.009 and TAD≥25 mm OR=30.538, 95%CI(2.935, 317.770), P=0.004 as independent risk factors for cutout failure. CONCLUSION The present study identified poor reduction quality and TAD≥25 mm as factors for cutout failure in geriatric intertrochanteric fractures treated with cephalomedullary nails. Further studies are needed to calculate the optimal TAD for cephalomedullary nails.
Humans ; Male ; Female ; Hip Fractures/surgery* ; Aged, 80 and over ; Aged ; Risk Factors ; Retrospective Studies ; Fracture Fixation, Intramedullary/adverse effects* ; Bone Nails ; Bone Screws

PURPOSE: We carried out the study aiming to explore and analyze the risk factors, the distribution of pathogenic bacteria, and their antibiotic-resistance characteristics influencing the occurrence of surgical site infection (SSI), to provide valuable assistance for reducing the incidence of SSI after traumatic fracture surgery. METHODS: A retrospective case-control study enrolling 3978 participants from January 2015 to December 2019 receiving surgical treatment for traumatic fractures was conducted at Tangdu Hospital of Air Force Medical University. Baseline data, demographic characteristics, lifestyles, variables related to surgical treatment, and pathogen culture were harvested and analyzed. Univariate analyses and multivariate logistic regression analyses were used to reveal the independent risk factors of SSI. A bacterial distribution histogram and drug-sensitive heat map were drawn to describe the pathogenic characteristics. RESULTS: Included 3978 patients 138 of them developed SSI with an incidence rate of 3.47% postoperatively. By logistic regression analysis, we found that variables such as gender (males) (odds ratio (OR) = 2.012, 95% confidence interval (CI): 1.235 - 3.278, p = 0.005), diabetes mellitus (OR = 5.848, 95% CI: 3.513 - 9.736, p < 0.001), hypoproteinemia (OR = 3.400, 95% CI: 1.280 - 9.031, p = 0.014), underlying disease (OR = 5.398, 95% CI: 2.343 - 12.438, p < 0.001), hormonotherapy (OR = 11.718, 95% CI: 6.269 - 21.903, p < 0.001), open fracture (OR = 29.377, 95% CI: 9.944 - 86.784, p < 0.001), and intraoperative transfusion (OR = 2.664, 95% CI: 1.572 - 4.515, p < 0.001) were independent risk factors for SSI, while, aged over 59 years (OR = 0.132, 95% CI: 0.059 - 0.296, p < 0.001), prophylactic antibiotics use (OR = 0.082, 95% CI: 0.042 - 0.164, p < 0.001) and vacuum sealing drainage use (OR = 0.036, 95% CI: 0.010 - 0.129, p < 0.001) were protective factors. Pathogens results showed that 301 strains of 38 species of bacteria were harvested, among which 178 (59.1%) strains were Gram-positive bacteria, and 123 (40.9%) strains were Gram-negative bacteria. Staphylococcus aureus (108, 60.7%) and Enterobacter cloacae (38, 30.9%) accounted for the largest proportion. The susceptibility of Gram-positive bacteria to Vancomycin and Linezolid was almost 100%. The susceptibility of Gram-negative bacteria to Imipenem, Amikacin, and Meropenem exceeded 73%. CONCLUSION Orthopedic surgeons need to develop appropriate surgical plans based on the risk factors and protective factors associated with postoperative SSI to reduce its occurrence. Meanwhile, it is recommended to strengthen blood glucose control in the early stage of admission and for surgeons to be cautious and scientific when choosing antibiotic therapy in clinical practice.
Humans ; Surgical Wound Infection/epidemiology* ; Male ; Female ; Risk Factors ; Retrospective Studies ; Middle Aged ; Adult ; Case-Control Studies ; Fractures, Bone/surgery* ; Aged ; Drug Resistance, Bacterial ; Logistic Models ; Anti-Bacterial Agents/therapeutic use* ; Incidence ; Bacteria/drug effects*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Natural polyphenols are a group of components widely found in traditional Chinese medicines and have been demonstrated to delay or prevent the development of aging and age-related diseases in recent years. As far as we know, the studies of natural polyphenols in aging and aging-related diseases have never been extensively reviewed. In the present paper, we reviewed recent advances of natural polyphenols in aging and common age-related diseases and the current technological methods to improve the bioavailability of natural polyphenols. The results showed that natural polyphenols have the potential to prevent or treat aging and common age-related diseases through multiple mechanisms. Nanotechnology, structural modifications, and matrix processing could provide strong technical support for the development of natural polyphenols to prevent or treat aging and age-related diseases. In conclusion, natural polyphenols have important potential in the prevention and treatment of aging and age-related diseases.

Glutamine provides carbon and nitrogen to support the proliferation of cancer cells. However, the precise reason why cancer cells are particularly dependent on glutamine remains unclear. In this study, we report that glutamine modulates the tumor suppressor F-box and WD repeat domain-containing 7 (FBW7) to promote cancer cell proliferation and survival. Specifically, lysine 604 (K604) in the sixth of the 7 substrate-recruiting WD repeats of FBW7 undergoes glutaminylation (Gln-K604) by glutaminyl tRNA synthetase. Gln-K604 inhibits SCFFBW7-mediated degradation of c-Myc and Mcl-1, enhances glutamine utilization, and stimulates nucleotide and DNA biosynthesis through the activation of c-Myc. Additionally, Gln-K604 promotes resistance to apoptosis by activating Mcl-1. In contrast, SIRT1 deglutaminylates Gln-K604, thereby reversing its effects. Cancer cells lacking Gln-K604 exhibit overexpression of c-Myc and Mcl-1 and display resistance to chemotherapy-induced apoptosis. Silencing both c-MYC and MCL-1 in these cells sensitizes them to chemotherapy. These findings indicate that the glutamine-mediated signal via Gln-K604 is a key driver of cancer progression and suggest potential strategies for targeted cancer therapies based on varying Gln-K604 status.
Glutamine/metabolism* ; Myeloid Cell Leukemia Sequence 1 Protein/genetics* ; Humans ; Proto-Oncogene Proteins c-myc/genetics* ; Cell Proliferation ; Signal Transduction ; Neoplasms/pathology* ; F-Box-WD Repeat-Containing Protein 7/genetics* ; Cell Survival ; Cell Line, Tumor ; Apoptosis

OBJECTIVE: Poxviruses are zoonotic pathogens that infect humans, mammals, vertebrates, and arthropods. However, the specific role of ticks in transmission and evolution of these viruses remains unclear. METHODS: Transcriptomic and metatranscriptomic raw data from 329 sampling pools of seven tick species across five continents were mined to assess the diversity and abundance of poxviruses. Chordopoxviral sequences were assembled and subjected to phylogenetic analysis to trace the origins of the unblasted fragments within these sequences. RESULTS: Fifty-eight poxvirus species, representing two subfamilies and 20 genera, were identified, with 212 poxviral sequences assembled. A substantial proportion of AT-rich fragments were detected in the assembled poxviral genomes. These genomic sequences contained fragments originating from rodents, archaea, and arthropods. CONCLUSION Our findings indicate that ticks play a significant role in the transmission and evolution of poxviruses. These viruses demonstrate the capacity to modulate virulence and adaptability through horizontal gene transfer, gene recombination, and gene mutations, thereby promoting co-existence and co-evolution with their hosts. This study advances understanding of the ecological dynamics of poxvirus transmission and evolution and highlights the potential role of ticks as vectors and vessels in these processes.
Animals ; Poxviridae/physiology* ; Ticks/virology* ; Phylogeny ; Transcriptome ; Evolution, Molecular ; Poxviridae Infections/virology* ; Genome, Viral

Objective The study aimed to investigate the impact of rare earth elements(REEs)exposure on pregnancy outcomes of in vitro fertilization-embryo transfer(IVF-ET)by analyzing samples from spouses. Methods A total of 141 couples were included.Blood and follicular fluid from the wives and semen plasma from the husbands,were analyzed for REEs using inductively coupled plasma mass spectrometry(ICP-MS).Spearman's correlation coefficients and the Mann-Whitney U test were used to assess correlations and compare REE concentrations among three types of samples,respectively.Logistic models were utilized to estimate the individual REE effect on IVF-ET outcomes,while BKMR and WQS models explored the mixture of REE interaction effects on IVF-ET outcomes. Results Higher La concentration in semen(median 0.089 ng/mL,P=0.03)was associated with a lower fertilization rate.However,this effect was not observed after artificial selection intervention through intracytoplasmic sperm injection(ICSI)(P=0.27).In semen,the REEs mixture did not exhibit any significant association with clinical pregnancy. Conclusion Our study revealed a potential association between high La exposure in semen and a decline in fertilization rate,but not clinical pregnancy rate.This is the first to report REEs concentrations in follicular fluid with La,Ce,Pr,and Nd found at significantly lower concentrations than in serum,suggesting that these four REEs may not accumulate in the female reproductive system.However,at the current exposure levels,mixed REEs exposure did not exhibit reproductive toxicity.