According to the World Health Organization (WHO) manual, sperm concentration should be measured using an improved Neubauer hemocytometer, while sperm motility should be measured by manual assessment. However, in China, thousands of laboratories do not use the improved Neubauer hemocytometer or method; instead, the Makler counting chamber is one of the most widely used chambers. To study sources of error that could impact the measurement of the apparent concentration and motility of sperm using the Makler counting chamber and to verify its accuracy for clinical application, 67 semen samples from patients attending the Department of Andrology, West China Second University Hospital, Sichuan University (Chengdu, China) between 13 September 2023 and 27 September 2023, were included. Compared with applying the cover glass immediately, delaying the application of the cover glass for 5 s, 10 s, and 30 s resulted in average increases in the sperm concentration of 30.3%, 74.1%, and 107.5%, respectively (all P < 0.0001) and in the progressive motility (PR) of 17.7%, 30.8%, and 39.6%, respectively (all P < 0.0001). However, when the semen specimens were fixed with formaldehyde, a delay in the application of the cover glass for 5 s, 10 s, and 30 s resulted in an average increase in the sperm concentration of 6.7%, 10.8%, and 14.6%, respectively, compared with immediate application of the cover glass. The accumulation of motile sperm due to delays in the application of the cover glass is a significant source of error with the Makler counting chamber and should be avoided.
Humans ; Male ; Sperm Motility/physiology* ; Sperm Count ; Semen Analysis/methods* ; Spermatozoa/physiology* ; Time Factors

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To construct a Z-score regression model for coronary artery diameter based on echocardiographic data from children in Sichuan Province and to establish a Z-score calculation formula. METHODS: A total of 744 healthy children who underwent physical examinations at Sichuan Provincial People's Hospital from January 2020 to December 2022 were selected as the modeling group, while 251 children diagnosed with Kawasaki disease at the same hospital from January 2018 to December 2022 were selected as the validation group. Pearson correlation analysis was conducted to analyze the relationships between coronary artery diameter values and age, height, weight, and body surface area. A regression model was constructed using function transformation to identify the optimal regression model and establish the Z-score calculation formula, which was then validated. RESULTS: The Pearson correlation analysis showed that the correlation coefficients for the diameters of the left main coronary artery, left anterior descending artery, left circumflex artery, and right coronary artery with body surface area were 0.815, 0.793, 0.704, and 0.802, respectively (P<0.05). Among the constructed regression models, the power function regression model demonstrated the best performance and was therefore chosen as the optimal model for establishing the Z-score calculation formula. Based on this Z-score calculation formula, the detection rate of coronary artery lesions was found to be 21.5% (54/251), which was higher than the detection rate based on absolute values of coronary artery diameter. Notably, in the left anterior descending and left circumflex arteries, the detection rate of coronary artery lesions using this Z-score calculation formula was higher than that of previous classic Z-score calculation formulas. CONCLUSIONS The Z-score calculation formula established based on the power function regression model has a higher detection rate for coronary artery lesions, providing a strong reference for clinicians, particularly in assessing coronary artery lesions in children with Kawasaki disease.
Humans ; Male ; Female ; Child, Preschool ; Child ; Coronary Artery Disease/diagnostic imaging* ; Infant ; Mucocutaneous Lymph Node Syndrome ; Regression Analysis ; Coronary Vessels/diagnostic imaging* ; Echocardiography ; Adolescent

Deactivation of the mitochondrial pyruvate dehydrogenase complex (PDC) is important for the metabolic switching of cancer cell from oxidative phosphorylation to aerobic glycolysis. Studies examining PDC activity regulation have mainly focused on the phosphorylation of pyruvate dehydrogenase (E1), leaving other post-translational modifications largely unexplored. Here, we demonstrate that the acetylation of Lys 488 of pyruvate dehydrogenase complex component X (PDHX) commonly occurs in hepatocellular carcinoma, disrupting PDC assembly and contributing to lactate-driven epigenetic control of gene expression. PDHX, an E3-binding protein in the PDC, is acetylated by the p300 at Lys 488, impeding the interaction between PDHX and dihydrolipoyl transacetylase (E2), thereby disrupting PDC assembly to inhibit its activation. PDC disruption results in the conversion of most glucose to lactate, contributing to the aerobic glycolysis and H3K56 lactylation-mediated gene expression, facilitating tumor progression. These findings highlight a previously unrecognized role of PDHX acetylation in regulating PDC assembly and activity, linking PDHX Lys 488 acetylation and histone lactylation during hepatocellular carcinoma progression and providing a potential biomarker and therapeutic target for further development.
Humans ; Acetylation ; Carcinoma, Hepatocellular/genetics* ; Liver Neoplasms/genetics* ; Pyruvate Dehydrogenase Complex/genetics* ; Gene Expression Regulation, Neoplastic ; Animals ; Mice ; Cell Line, Tumor ; Protein Processing, Post-Translational ; Histones/metabolism* ; Disease Progression

Objective To investigate the effects of laparoscopic sleeve gastrectomy(LSG)on the cardiac structure and function in obese patients with heart failure(HF)and compare the efficacy of LSG across obese patients with different HF types.Methods This study included 33 obese patients with HF who underwent LSG.The clinical indicators were compared between before operation and 12 months after operation.Repeated measures analysis of variance was employed to evaluate the changes in echocardiographic parameters before operation and 3,6,and 12 months after operation.Patients were allocated into a HF with preserved ejection fraction group(n=17),a HF with mildly reduced ejection fraction group(n=5)and a HF with reduced ejection fraction(HFrEF)group(n=11)based on left ventricular ejection fraction(LVEF)before operation for subgroup analyses of the effects of LSG on the cardiac structure and function of obese patients with HF.The paired samples t-test was conducted to assess the degree of cardiac structural and functional alterations after LSG.Results The 33 patients included 69.7% males,with an average age of(35.3±9.9)years,and a body mass index(BMI)of(51.2±9.8)kg/m².The median follow-up was 9.0(5.0,13.3)months.Compared with the preoperative values,the postoperative BMI(P=0.002),body surface area(BSA)(P=0.009),waist circumference(P=0.010),hip circumference(P=0.031),body fat content(P=0.007),and percentage of patients with cardiac function grades Ⅲ-IV(P<0.001)decreased.At the 12-month follow-up left atrial diameter(P=0.006),right atrial long-axis inner diameter(RAD1)(P<0.001),right atrial short-axis inner diameter(RAD2)(P<0.001),right ventricular inner diameter(P=0.002),interventricular septal thickness at end-diastolic(P=0.002),and left ventricular end-diastolic volumes(P=0.004)and left ventricular end-systolic volumes(P=0.003) all significantly reduced compared with preoperative values.Additionally,left ventricular fractional shortening and LVEF improved(both P<0.001).Subgroup analyses revealed that cardiac structural parameters significantly decreased in the HF with preserved ejection fraction,HF with mildly reduced ejection fraction,and HFrEF subgroups compared with preoperative values.Notably,the HFrEF group demonstrated the best performance in terms of left atrial diameter(P=0.003),left ventricular inner diameter at end-diastole(P=0.008),RAD1(P<0.001),RAD2(P=0.004),right ventricular inner diameter(P=0.019),left ventricular end-diastolic volume(P=0.004)and left ventricular end-systolic volume(P=0.001),cardiac output(P=0.006),tricuspid regurgitation velocity(P=0.002),and pulmonary artery systolic pressure(P=0.001) compared to preoperatively.Postoperative left ventricular fractional shortening(P<0.001,P=0.003,P<0.001)and LVEF(P<0.001,P=0.011,P=0.001)became higher in all the three subgroups than the preoperative values.Conclusions LSG decreased the body weight,BMI,and BSA,improved the cardiac function grade,reversed the enlargement of the left atrium and left ventricle,reduced the right atrium and right ventricle,and enhanced the left ventricular systolic function.It was effective across obese patients with different HF types.Particularly,LSG demonstrates the best performance in improving the structures of both atria and ventricles in obese patients with HFrEF.
Humans ; Male ; Female ; Gastrectomy/methods* ; Heart Failure/complications* ; Adult ; Obesity/physiopathology* ; Laparoscopy ; Middle Aged ; Heart/physiopathology* ; Stroke Volume

This study aimed to investigate the therapeutic effects of Morinda officinalis iridoid glycosides (MOIG) on bone loss of rheumatoid arthritis (RA) rats, and the mechanism of osteoclast function and activity induced by lipopolysaccharide (LPS). RA rats were established by injecting bovin type II collagen. The Bio-ethic Committee of Zhejiang Chinese Medical University approved all experimental protocols associated with this study (IACUC-20180410-03). The collagen-induced arthritis (CIA) rats were administered drug by gavage for 8 weeks; the femoral trabecular micro-structure changes were observed in CIA rats by micro-CT; the LPS-induced osteoclasts model further observed the effect and mechanism of anti-inflammatory osteoporosis in vitro. The results indicated that MOIG could markedly increase bone mineral density (BMD) in CIA rats, improve trabecular micro-structure. In vitro studies demonstrated that MOIG could significantly inhibit osteoclastogensis and differentiation, suppress tartrate resistant acid phosphatase (TRAP) activity, F-actin ring formation, TNF receptor associated factor 6 (TRAF6) recruitment, and inhibitor of nuclear factor kappa-Bα (IκBα) degradation as well as p65 phosphorylation, thereby repressing nuclear factor kappa-B (NF-κB) signaling pathway activation. Subsequently, MOIG effectively inhibited osteoclast nuclear factor of activated T-cells c1 (NFATc1) and cellular oncogene Fos (c-Fos) expression, as well as bone resorption related protein activity including matrix metalloprotein 9 (MMP-9) and cathepsin K (CtsK). Meanwhile, MOIG also repressed the phosphorylation expression of Janus activating kinase 2 (JAK2) and signal transducer and activator of transcription 3 (STAT3), thereby inhibiting JAK2/STAT3 signaling pathway activation. Moreover, further studies found that MOIG could suppress glycogen synthase kinase-3β (GSK-3β) activity, and GSK-3β gene silencing could markedly inhibit oetsoclast F-actin ring formation as well as the phosphorylation expression of p65 and STAT3. Of note, compared with GSK-3β gene silencing group, there was no significant difference in the group treated with both MOIG with GSK-3β gene silencing simultaneously. Thus, the results suggested that MOIG may inhibit NF-κB signaling pathway and JAK2/STAT3 signaling pathway activation via regulating GSK-3β, thereby alleviating bone destruction in RA.

This experiment aims to study the taste-masking effects of different kinds of corrigent used individually and in combination on ibuprofen oral solution, in order to optimize the taste-masking formulation. Firstly, a wide range of corrigent and the mass fractions were extensively screened using electronic tongue technology. Subsequently, a combination of sensory evaluation, analytic hierarchy process (AHP)-fuzzy mathematics evaluation, and Box-Behnken experimental design were employed to comprehensively assess the taste-masking effects of different combinations of corrigent on ibuprofen oral solution, optimize the taste-masking formulation, and validate the results. The study received ethical approval from the Review Committee of the Beijing University of Chinese Medicine (ethical code: 2024BZYLL0102). The results showed that corrigent fractions and types were screened separately through single-factor experiments. Subsequently, a Box-Behnken response surface design combined with AHP and fuzzy mathematics evaluation was used to fit a functional model: Z = 688.310 11 - 3 023.722 22X₁ - 11.477 00X₂ + 62.721 67X₃ + 14.600 00X₁X₂ - 179.666 67X₁X₃ - 3.152 00X₂X₃ + 4 031.111 11X₁² + 0.525 28X₂² + 9.772 00X₃². This model is stable and reliable, determining the optimal taste-masking formulation to be 3.9 g·L^-1 of stevioside, 100 g L^-1 of xylitol, and 30 g L^-1 of methyl-β-cyclodextrin. The comprehensive score of the verification test is 88.14, with a relative RSD of 0.39%, indicating the feasibility of this model. This study achieved the improvement of the taste of ibuprofen oral solution through a combination of objective and subjective methods. Three types of corrigent were identified for enhancing drug taste, leading to the selection of the optimal taste-masking formulation for ibuprofen oral solution. This significantly enhanced the taste of the original formulation, improved patient compliance, and offered a new approach to mitigating the undesirable taste of formulations.

Objective To explore the distribution of traditional Chinese medicine(TCM)syndrome elements in patients with multi-drug resistant bacteria-infected pneumonia.Methods Clinical data of 126 patients with multi-drug resistant bacteria-infected pneumonia admitted to the intensive care unit of Lung Disease Centre of Qingdao Hospital of Traditional Chinese Medicine from May 2020 to July 2022 were retrospectively collected.The clinical data included the patients'gender,age,underlying diseases,history of bad additions of smoking and alcohol,multi-drug resistant bacteria,and the information of four diagnostic methods of TCM,etc.The disease-nature syndrome elements in patients with drug-resistance to various strains of drug-resistant bacteria were extracted,and then deficiency-excess syndrome differentiation was carried out.Results(1)A total of 201 strains of multi-drug resistant bacteria were detected in 126 patients with multi-drug resistant bacterial pneumonia.The main pathogenic species were Gram-negative bacteria,and the proportion accounted for 95.52%(192/201),which was significantly higher than that of Gram-positive bacteria[4.48%(9/201)],with a statistically significant difference(χ2 = 166.612,P＜0.001).Klebsiella pneumoniae accounted for the highest percentage of 23.38%in the gram-negative bacterium.(2)A total of 12 syndrome elements were extracted from the 126 patients.The excess syndrome elements were predominated by phlegm and heat,and the deficiency syndrome elements were predominated by yin deficiency.There was no statistically significant difference in the distribution of yin deficiency,blood deficiency,heat,phlegm,fluid-retention and damp syndrome elements among patients with different strains of drug-resistant bacterial infection(P＞0.05).(3)Of the 126 patients,62 cases(49.21%)had simple excess syndrome,one case(0.79%)had simple deficiency syndrome,and 63 cases(50.00%)had concurrent deficiency-excess syndrome.Among the 126 patients,there were 19 cases of single syndrome element,41 cases of concurrent two-syndrome element,49 cases of concurrent three-syndrome element,16 cases of concurrent four-syndrome element,and one case of concurrent five-syndrome element.And the combined syndrome element of phlegm-heat-yin deficiency occurred most frequently for 26 times.Conclusion Gram-negative bacteria are the primary infectious pathogens for the patients with multi-drug resistant bacterial infections,and the TCM syndrome elements of the patients are characterized by the concurrence of deficiency and excess and simple excess syndrome,mainly manifesting as phlegm,heat,and yin deficiency.