In this paper， by referring to ancient and modern literature， the textual research of Inulae Flos has been conducted to clarify the name， origin， production area， quality evaluation， harvesting， processing and others， so as to provide reference and basis for the development and utilization of famous classical formulas containing this herb. After textual research， it could be verified that the medicinal use of Inulae Flos was first recorded in Shennong Bencaojing of the Han dynasty. In successive dynasties， Xuanfuhua has been taken as the official name， and it also has other alternative names such as Jinfeicao， Daogeng and Jinqianhua. The period before the Song and Yuan dynasties， the main origin of Inulae Flos was the Asteraceae plant Inula japonica， and from the Ming and Qing dynasties to the present， I. japonica and I. britannica are the primary source. In addition to the dominant basal species， there are also regional species such as I. linariifolia， I. helianthus-aquatili， and I. hupehensis. The earliest recorded production areas in ancient times were Henan， Hubei and other places， and the literature records that it has been distributed throughout the country since modern times. The medicinal part is its flower， the harvesting and processing method recorded in the past dynasties is mainly harvested in the fifth and ninth lunar months， and dried in the sun， and the modern harvesting is mostly harvested in summer and autumn when the flowers bloom， in order to remove impurities， dry in the shade or dry in the sun. In addition， the roots， whole herbs and aerial parts are used as medicinal materials. In ancient times， there were no records about the quality of Inulae Flos， and in modern times， it is generally believed that the quality of complete flower structure， small receptacles， large blooms， yellow petals， long filaments， many fluffs， no fragments， and no branches is better. Ancient processing methods primarily involved cleaning， steaming， and sun-drying， supplemented by techniques such as boiling， roasting， burning， simmering， stir-frying， and honey-processing. Modern processing focuses mainly on cleaning the stems and leaves before use. Regarding the medicinal properties， ancient texts describe it as salty and sweet in taste， slightly warm in nature， and mildly toxic. Modern studies characterize it as bitter， pungent， and salty in taste， with a slightly warm nature. Its therapeutic effects remain consistent across eras， including descending Qi， resolving phlegm， promoting diuresis， and stopping vomiting. Based on the research results， it is recommended that when developing famous classical formulas containing Inulae Flos， either I. japonica or I. britannica should be used as the medicinal source. Processing methods should follow formula requirements， where no processing instructions are specified， the raw products may be used after cleaning.

In this paper， by referring to ancient and modern literature， the textual research of Inulae Flos has been conducted to clarify the name， origin， production area， quality evaluation， harvesting， processing and others， so as to provide reference and basis for the development and utilization of famous classical formulas containing this herb. After textual research， it could be verified that the medicinal use of Inulae Flos was first recorded in Shennong Bencaojing of the Han dynasty. In successive dynasties， Xuanfuhua has been taken as the official name， and it also has other alternative names such as Jinfeicao， Daogeng and Jinqianhua. The period before the Song and Yuan dynasties， the main origin of Inulae Flos was the Asteraceae plant Inula japonica， and from the Ming and Qing dynasties to the present， I. japonica and I. britannica are the primary source. In addition to the dominant basal species， there are also regional species such as I. linariifolia， I. helianthus-aquatili， and I. hupehensis. The earliest recorded production areas in ancient times were Henan， Hubei and other places， and the literature records that it has been distributed throughout the country since modern times. The medicinal part is its flower， the harvesting and processing method recorded in the past dynasties is mainly harvested in the fifth and ninth lunar months， and dried in the sun， and the modern harvesting is mostly harvested in summer and autumn when the flowers bloom， in order to remove impurities， dry in the shade or dry in the sun. In addition， the roots， whole herbs and aerial parts are used as medicinal materials. In ancient times， there were no records about the quality of Inulae Flos， and in modern times， it is generally believed that the quality of complete flower structure， small receptacles， large blooms， yellow petals， long filaments， many fluffs， no fragments， and no branches is better. Ancient processing methods primarily involved cleaning， steaming， and sun-drying， supplemented by techniques such as boiling， roasting， burning， simmering， stir-frying， and honey-processing. Modern processing focuses mainly on cleaning the stems and leaves before use. Regarding the medicinal properties， ancient texts describe it as salty and sweet in taste， slightly warm in nature， and mildly toxic. Modern studies characterize it as bitter， pungent， and salty in taste， with a slightly warm nature. Its therapeutic effects remain consistent across eras， including descending Qi， resolving phlegm， promoting diuresis， and stopping vomiting. Based on the research results， it is recommended that when developing famous classical formulas containing Inulae Flos， either I. japonica or I. britannica should be used as the medicinal source. Processing methods should follow formula requirements， where no processing instructions are specified， the raw products may be used after cleaning.

BACKGROUND: Epoxyeicosatrienoic acids (EETs), which are metabolites of arachidonic acid catalyzed by cytochrome P450 epoxygenase, are degraded into inactive dihydroxyeicosatrienoic acids by soluble epoxide hydrolase (sEH). Many studies have revealed that sEH gene deletion exerts protective effects against diabetes. Vascular calcification is a common complication of diabetes, but the potential effects of sEH on diabetic vascular calcification are still unknown. METHODS: The level of aortic calcification in wild-type and Ephx2-/- C57BL/6 diabetic mice induced with streptozotocin was evaluated by measuring the aortic calcium content through alizarin red staining, immunohistochemistry staining, and immunofluorescence staining. Mouse vascular smooth muscle cell lines (MOVAS cells) treated with β-glycerol phosphate (0.01 mol/L) plus advanced glycation end products (50 mg/L) were used to investigate the effects of sEH inhibitors or sEH knockdown and EETs on the calcification of vascular smooth muscle cells, which was detected by Western blotting, alizarin red staining, and Von Kossa staining. RESULTS: sEH gene deletion significantly inhibited diabetic vascular calcification by increasing levels of EETs in the aortas of mice. EETs (especially 11,12-EET and 14,15-EET) efficiently prevented the osteogenic transdifferentiation of MOVAS cells by decreasing nidogen-2 (NID2) expression. Interestingly, suppressing sEH activity by small interfering ribonucleic acid or specific inhibitors did not block osteogenic transdifferentiation of MOVAS cells induced by β-glycerol phosphate and advanced glycation end products. NID2 overexpression significantly abolished the inhibitory effect of sEH gene deletion on diabetic vascular calcification. Moreover, NID2 overexpression mediated by adeno-associated virus 9 vectors markedly increased insulin-like growth factor 2 (IGF2) and phospho-ERK1/2 expression in MOVAS cells. Overall, sEH gene knockout inhibited diabetic vascular calcification by decreasing aortic NID2 expression and, then, inactivating the downstream IGF2-ERK1/2 signaling pathway. CONCLUSIONS sEH gene deletion markedly inhibited diabetic vascular calcification through repressed osteogenic transdifferentiation of vascular smooth muscle cells mediated by increased aortic EET levels, which was associated with decreased NID2 expression and inactivation of the downstream IGF2-ERK1/2 signaling pathway.
Animals ; Mice ; Vascular Calcification/metabolism* ; Mice, Inbred C57BL ; Epoxide Hydrolases/metabolism* ; Diabetes Mellitus, Experimental/genetics* ; Male ; Gene Deletion ; MAP Kinase Signaling System/genetics* ; Cell Line ; Immunohistochemistry ; Muscle, Smooth, Vascular/metabolism* ; Signal Transduction/genetics* ; Mice, Knockout

PANoptosis is a type of programmed cell death regulated by the PANoptosome with key features of pyroptosis, apoptosis and/or necroptosis. As the most complex programmed cell death, PANoptosis emphasizes the compensatory role among multiple programmed cell deaths, and can regulate malignant phenotypes such as proliferation, migration, and invasion of tumor cells through multiple signaling pathways, thus affecting malignant tumor progression. It has been found that PANoptosis plays a dual role in tumor progression and treatment. Therefore, it is clinically important to understand the molecular mechanisms by which PANoptosis affects tumorigenesis, development and progression. This paper reviews the molecular mechanisms of apoptosis, pyroptosis and necroptosis, and discusses the activation and regulation mechanisms of PANoptosis and PANoptosome as well as the research progress on the role of PANoptosis in tumors, aiming to provide new ideas for cancer treatment and prognostic assessment.
Humans ; Neoplasms/physiopathology* ; Pyroptosis/physiology* ; Apoptosis/physiology* ; Necroptosis/physiology* ; Signal Transduction ; Animals

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To evaluate the effectiveness of single-balloon and double-balloon enteroscopy in diagnosing pediatric small bowel diseases and assess the diagnostic efficacy of computed tomography enterography (CTE) for small bowel diseases using enteroscopy as the reference standard. METHODS: Clinical data from 576 children who underwent enteroscopy at Hunan Children's Hospital between January 2017 and December 2023 were retrospectively collected. The children were categorized based on enteroscopy type into the single-balloon enteroscopy (SBE) group (n=457) and double-balloon enteroscopy (DBE) group (n=119), and the clinical data were compared between the two groups. The sensitivity and specificity of CTE for diagnosing small bowel diseases were evaluated using enteroscopy results as the standard. RESULTS: Among the 576 children, small bowel lesions were detected by enteroscopy in 274 children (47.6%).There was no significant difference in lesion detection rates or complication rates between the SBE and DBE groups (P>0.05), but the DBE group had deeper insertion, longer procedure time, and higher complete small bowel examination rate (P<0.05). The complication rate during enteroscopy was 4.3% (25/576), with 18 cases (3.1%) of mild complications and 7 cases (1.2%) of severe complications, which improved with symptomatic treatment, surgical, or endoscopic intervention. Among the 412 children who underwent CTE, the sensitivity and specificity for diagnosing small bowel diseases were 44.4% and 71.3%, respectively. CONCLUSIONS SBE and DBE have similar diagnostic efficacy for pediatric small bowel diseases, but DBE is preferred for suspected deep small bowel lesions and comprehensive small bowel examination. Enteroscopy in children demonstrates relatively good overall safety. CTE demonstrates relatively low sensitivity but comparatively high specificity for diagnosing small bowel diseases.
Retrospective Studies ; Treatment Outcome ; Double-Balloon Enteroscopy/statistics & numerical data* ; Single-Balloon Enteroscopy/statistics & numerical data* ; Humans ; Male ; Female ; Child ; Operative Time ; Tomography, X-Ray Computed/statistics & numerical data* ; Sensitivity and Specificity ; Intestine, Small/surgery* ; Intestinal Diseases/surgery*

OBJECTIVE: To investigate the influence of different scanning conditions on the image quality of medical electron accelerator cone-beam computed tomography (CBCT) and provide a reference for the selection of scanning conditions for different body parts. Methods Set different scanning conditions, the Catphan 503 phantom was scanned using CBCT parameters to analyze the influence of spatial resolution, noise, uniformity, spatial geometric accuracy, and low-contrast resolution on the image quality of CBCT. RESULTS: For the head, chest, and abdomen, with the increase in scanning parameter values, the noise value decreased by 47.4%, 26.1%, and 51.3% respectively, and the uniformity values decreased by 30.2%, 26.6%, and 47.9% respectively. The low-contrast resolution values decreased by 50.6%, 34.2%, and 12.0%. The influence of different scanning conditions on spatial geometric accuracy and spatial resolution is not significant. CONCLUSION Different scanning parameters have a certain influence on the image quality of medical electron accelerator CBCT. Lower scanning parameters can be selected based on individual patients to reduce the additional radiation dose, providing a reference for the safe application of CBCT image guidance in radiotherapy.
Cone-Beam Computed Tomography/instrumentation* ; Phantoms, Imaging ; Particle Accelerators

OBJECTIVES: To investigate the structural changes of rat thoracic aorta and changes in expression levels of Bmal1 and cyclins in thoracic aorta endothelial cells following heat stress. METHODS: Twenty male SD rats were randomized equally into control group and heat stress group. After exposure to 32 ℃ for 2 weeks in the latter group, the rats were examined for histopathological changes and Bmal1 expression in the thoracic aorta using HE staining and immunohistochemistry. In the cell experiments, cultured rat thoracic aortic endothelial cells (RTAECs) were incubated at 40 ℃ for 12 h with or without prior transfection with a Bmal1-specific small interfering RNA (si-Bmal1) or a negative sequence. In both rat thoracic aorta and RTAECs, the expressions of Bmal1, the cell cycle proteins CDK1, CDK4, CDK6, and cyclin B1, and apoptosis-related proteins Bax and Bcl-2 were detected using Western blotting. TUNEL staining was used to detect cell apoptosis in rat thoracic aorta, and the changes in cell cycle distribution and apoptosis in RTAECs were analyzed with flow cytometry. RESULTS: Compared with the control rats, the rats exposed to heat stress showed significantly increased blood pressures and lowered heart rate with elastic fiber disruption and increased expressions of Bmal1, cyclin B1 and CDK1 in the thoracic aorta (P<0.05). In cultured RTAECs, heat stress caused significant increase of Bmal1, cyclin B1 and CDK1 protein expression levels, which were obviously lowered in cells with prior si-Bmal1 transfection. Bmal1 knockdown also inhibited heat stress-induced increase of apoptosis in RTAECs as evidenced by decreased expression of Bax and increased expression of Bcl-2. CONCLUSIONS Heat stress upregulates Bmal1 expression and causes alterations in expressions of cyclins to trigger apoptosis of rat thoracic aorta endothelial cells, which can be partly alleviated by suppressing Bmal1 expression.
Animals ; ARNTL Transcription Factors/genetics* ; Male ; Aorta, Thoracic/metabolism* ; Rats ; Rats, Sprague-Dawley ; Endothelial Cells/metabolism* ; Apoptosis ; Cells, Cultured ; Heat-Shock Response ; Cyclin B1/metabolism* ; CDC2 Protein Kinase/metabolism* ; Cyclins/metabolism* ; RNA, Small Interfering ; bcl-2-Associated X Protein/metabolism*

Cemental tear is a rare and indetectable condition unless obvious clinical signs present with the involvement of surrounding periodontal and periapical tissues. Due to its clinical manifestations similar to common dental issues, such as vertical root fracture, primary endodontic diseases, and periodontal diseases, as well as the low awareness of cemental tear for clinicians, misdiagnosis often occurs. The critical principle for cemental tear treatment is to remove torn fragments, and overlooking fragments leads to futile therapy, which could deteriorate the conditions of the affected teeth. Therefore, accurate diagnosis and subsequent appropriate interventions are vital for managing cemental tear. Novel diagnostic tools, including cone-beam computed tomography (CBCT), microscopes, and enamel matrix derivatives, have improved early detection and management, enhancing tooth retention. The implementation of standardized diagnostic criteria and treatment protocols, combined with improved clinical awareness among dental professionals, serves to mitigate risks of diagnostic errors and suboptimal therapeutic interventions. This expert consensus reviewed the epidemiology, pathogenesis, potential predisposing factors, clinical manifestations, diagnosis, differential diagnosis, treatment, and prognosis of cemental tear, aiming to provide a clinical guideline and facilitate clinicians to have a better understanding of cemental tear.
Humans ; Dental Cementum/injuries* ; Consensus ; Diagnosis, Differential ; Cone-Beam Computed Tomography ; Tooth Fractures/therapy*

Objective : To evaluate the coverage and spatial clustering of 13-valent pneumococcal conjugate vaccine(PCV13) among the 2017—2023 birth cohorts in Anhui Province. Methods : Obtained vaccination data of PCV13 for children born in 2017—2023 from the Anhui Immunization Information Management System.We estimated coverage levels and described characteristics of coverage.The spatial autocorrelation analysis of coverage was conducted. Results : Cumulative coverage,cumulative primary immunization coverage and cumulative full-series coverage of PCV13 were 17.19%,12.12% and 9.09% among the 2017—2023 birth cohort in Anhui Province.The coverage of PCV13 increased from 1.14% in the 2017 birth cohort to 41.59% in the 2022 birth cohort.The first dose of PCV13 at ages under 3,3—6,7—11,12—23 and not less than 24 months were 45.35%,29.84%,5.52%,10.75% and 8.53%,respectively.There were significant differences in the ages of the first dose between children of different years of born and kinds of PCV13(P<0.001).Significant differences were also observed in the cumulative coverage,cumulative primary immunization coverage,cumulative full-series coverage of PCV13 and ages of the first dose among children from various residence regions(P<0.001).From 2018 to 2023 birth cohort,the coverage of PCV13 in Anhui Province showed obvious positive spatial autocorrelation.Local spatial autocorrelation analysis showed that the "high-high" agglomeration areas were concentrated in the central area of Anhui. Conclusion The coverage of PCV13 was low in Anhui Province with significant regional differences.