Background: The genetic basis for hyperglycaemia in pregnancy remain unclear. This study aimed to uncover the genetic determinants of gestational diabetes mellitus (GDM) and investigate their applications. Methods: We performed a meta-analysis of genome-wide association studies (GWAS) for GDM in Chinese women (464 cases and 1,217 controls), followed by de novo replications in an independent Chinese cohort (564 cases and 572 controls) and in silico replication in European (12,332 cases and 131,109 controls) and multi-ethnic populations (5,485 cases and 347,856 controls). A polygenic risk score (PRS) was derived based on the identified variants. Results: Using the genome-wide scan and candidate gene approaches, we identified four susceptibility loci for GDM. These included three previously reported loci for GDM and type 2 diabetes mellitus (T2DM) at MTNR1B (rs7945617, odds ratio [OR], 1.64; 95% confidence interval [CI],1.38 to 1.96]), CDKAL1 (rs7754840, OR, 1.33; 95% CI, 1.13 to 1.58), and INS-IGF2-KCNQ1 (rs2237897, OR, 1.48; 95% CI, 1.23 to 1.79), as well as a novel genome-wide significant locus near TBR1-SLC4A10 (rs117781972, OR, 2.05; 95% CI, 1.61 to 2.62; Pmeta=7.6×10-9), which has not been previously reported in GWAS for T2DM or glycaemic traits. Moreover, we found that women with a high PRS (top quintile) had over threefold (95% CI, 2.30 to 4.09; Pmeta=3.1×10-14) and 71% (95% CI, 1.08 to 2.71; P=0.0220) higher risk for GDM and abnormal glucose tolerance post-pregnancy, respectively, compared to other individuals. Conclusion Our results indicate that the genetic architecture of glucose metabolism exhibits both similarities and differences between the pregnant and non-pregnant states. Integrating genetic information can facilitate identification of pregnant women at a higher risk of developing GDM or later diabetes.

Background: The genetic basis for hyperglycaemia in pregnancy remain unclear. This study aimed to uncover the genetic determinants of gestational diabetes mellitus (GDM) and investigate their applications. Methods: We performed a meta-analysis of genome-wide association studies (GWAS) for GDM in Chinese women (464 cases and 1,217 controls), followed by de novo replications in an independent Chinese cohort (564 cases and 572 controls) and in silico replication in European (12,332 cases and 131,109 controls) and multi-ethnic populations (5,485 cases and 347,856 controls). A polygenic risk score (PRS) was derived based on the identified variants. Results: Using the genome-wide scan and candidate gene approaches, we identified four susceptibility loci for GDM. These included three previously reported loci for GDM and type 2 diabetes mellitus (T2DM) at MTNR1B (rs7945617, odds ratio [OR], 1.64; 95% confidence interval [CI],1.38 to 1.96]), CDKAL1 (rs7754840, OR, 1.33; 95% CI, 1.13 to 1.58), and INS-IGF2-KCNQ1 (rs2237897, OR, 1.48; 95% CI, 1.23 to 1.79), as well as a novel genome-wide significant locus near TBR1-SLC4A10 (rs117781972, OR, 2.05; 95% CI, 1.61 to 2.62; Pmeta=7.6×10-9), which has not been previously reported in GWAS for T2DM or glycaemic traits. Moreover, we found that women with a high PRS (top quintile) had over threefold (95% CI, 2.30 to 4.09; Pmeta=3.1×10-14) and 71% (95% CI, 1.08 to 2.71; P=0.0220) higher risk for GDM and abnormal glucose tolerance post-pregnancy, respectively, compared to other individuals. Conclusion Our results indicate that the genetic architecture of glucose metabolism exhibits both similarities and differences between the pregnant and non-pregnant states. Integrating genetic information can facilitate identification of pregnant women at a higher risk of developing GDM or later diabetes.

Background: The genetic basis for hyperglycaemia in pregnancy remain unclear. This study aimed to uncover the genetic determinants of gestational diabetes mellitus (GDM) and investigate their applications. Methods: We performed a meta-analysis of genome-wide association studies (GWAS) for GDM in Chinese women (464 cases and 1,217 controls), followed by de novo replications in an independent Chinese cohort (564 cases and 572 controls) and in silico replication in European (12,332 cases and 131,109 controls) and multi-ethnic populations (5,485 cases and 347,856 controls). A polygenic risk score (PRS) was derived based on the identified variants. Results: Using the genome-wide scan and candidate gene approaches, we identified four susceptibility loci for GDM. These included three previously reported loci for GDM and type 2 diabetes mellitus (T2DM) at MTNR1B (rs7945617, odds ratio [OR], 1.64; 95% confidence interval [CI],1.38 to 1.96]), CDKAL1 (rs7754840, OR, 1.33; 95% CI, 1.13 to 1.58), and INS-IGF2-KCNQ1 (rs2237897, OR, 1.48; 95% CI, 1.23 to 1.79), as well as a novel genome-wide significant locus near TBR1-SLC4A10 (rs117781972, OR, 2.05; 95% CI, 1.61 to 2.62; Pmeta=7.6×10-9), which has not been previously reported in GWAS for T2DM or glycaemic traits. Moreover, we found that women with a high PRS (top quintile) had over threefold (95% CI, 2.30 to 4.09; Pmeta=3.1×10-14) and 71% (95% CI, 1.08 to 2.71; P=0.0220) higher risk for GDM and abnormal glucose tolerance post-pregnancy, respectively, compared to other individuals. Conclusion Our results indicate that the genetic architecture of glucose metabolism exhibits both similarities and differences between the pregnant and non-pregnant states. Integrating genetic information can facilitate identification of pregnant women at a higher risk of developing GDM or later diabetes.

Background: The genetic basis for hyperglycaemia in pregnancy remain unclear. This study aimed to uncover the genetic determinants of gestational diabetes mellitus (GDM) and investigate their applications. Methods: We performed a meta-analysis of genome-wide association studies (GWAS) for GDM in Chinese women (464 cases and 1,217 controls), followed by de novo replications in an independent Chinese cohort (564 cases and 572 controls) and in silico replication in European (12,332 cases and 131,109 controls) and multi-ethnic populations (5,485 cases and 347,856 controls). A polygenic risk score (PRS) was derived based on the identified variants. Results: Using the genome-wide scan and candidate gene approaches, we identified four susceptibility loci for GDM. These included three previously reported loci for GDM and type 2 diabetes mellitus (T2DM) at MTNR1B (rs7945617, odds ratio [OR], 1.64; 95% confidence interval [CI],1.38 to 1.96]), CDKAL1 (rs7754840, OR, 1.33; 95% CI, 1.13 to 1.58), and INS-IGF2-KCNQ1 (rs2237897, OR, 1.48; 95% CI, 1.23 to 1.79), as well as a novel genome-wide significant locus near TBR1-SLC4A10 (rs117781972, OR, 2.05; 95% CI, 1.61 to 2.62; Pmeta=7.6×10-9), which has not been previously reported in GWAS for T2DM or glycaemic traits. Moreover, we found that women with a high PRS (top quintile) had over threefold (95% CI, 2.30 to 4.09; Pmeta=3.1×10-14) and 71% (95% CI, 1.08 to 2.71; P=0.0220) higher risk for GDM and abnormal glucose tolerance post-pregnancy, respectively, compared to other individuals. Conclusion Our results indicate that the genetic architecture of glucose metabolism exhibits both similarities and differences between the pregnant and non-pregnant states. Integrating genetic information can facilitate identification of pregnant women at a higher risk of developing GDM or later diabetes.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To investigate the structural changes of rat thoracic aorta and changes in expression levels of Bmal1 and cyclins in thoracic aorta endothelial cells following heat stress. METHODS: Twenty male SD rats were randomized equally into control group and heat stress group. After exposure to 32 ℃ for 2 weeks in the latter group, the rats were examined for histopathological changes and Bmal1 expression in the thoracic aorta using HE staining and immunohistochemistry. In the cell experiments, cultured rat thoracic aortic endothelial cells (RTAECs) were incubated at 40 ℃ for 12 h with or without prior transfection with a Bmal1-specific small interfering RNA (si-Bmal1) or a negative sequence. In both rat thoracic aorta and RTAECs, the expressions of Bmal1, the cell cycle proteins CDK1, CDK4, CDK6, and cyclin B1, and apoptosis-related proteins Bax and Bcl-2 were detected using Western blotting. TUNEL staining was used to detect cell apoptosis in rat thoracic aorta, and the changes in cell cycle distribution and apoptosis in RTAECs were analyzed with flow cytometry. RESULTS: Compared with the control rats, the rats exposed to heat stress showed significantly increased blood pressures and lowered heart rate with elastic fiber disruption and increased expressions of Bmal1, cyclin B1 and CDK1 in the thoracic aorta (P<0.05). In cultured RTAECs, heat stress caused significant increase of Bmal1, cyclin B1 and CDK1 protein expression levels, which were obviously lowered in cells with prior si-Bmal1 transfection. Bmal1 knockdown also inhibited heat stress-induced increase of apoptosis in RTAECs as evidenced by decreased expression of Bax and increased expression of Bcl-2. CONCLUSIONS Heat stress upregulates Bmal1 expression and causes alterations in expressions of cyclins to trigger apoptosis of rat thoracic aorta endothelial cells, which can be partly alleviated by suppressing Bmal1 expression.
Animals ; ARNTL Transcription Factors/genetics* ; Male ; Aorta, Thoracic/metabolism* ; Rats ; Rats, Sprague-Dawley ; Endothelial Cells/metabolism* ; Apoptosis ; Cells, Cultured ; Heat-Shock Response ; Cyclin B1/metabolism* ; CDC2 Protein Kinase/metabolism* ; Cyclins/metabolism* ; RNA, Small Interfering ; bcl-2-Associated X Protein/metabolism*

Objective To investigate the associations of reproductive health indicators with lung function and chronic obstructive pulmonary disease(COPD)among women aged 40 years and above.Methods From Jul to Sep,2021,female subjects aged 40 years and above were randomly selected from the Shanghai Suburban Adult Cohort and Biobank for COPD screening.A questionnaire was used to obtain information on demographic characteristics and reproductive health indicators.Linear regression was used to analyze the effects of reproductive health indicators on forced vital capacity(FVC)and forced expiratory volume in the first second(FEV1).Logistic regression was also used to analyze the effects of reproductive health factors on FVC as a percentage of the predicted value(FVC%Pred)and FEV1%Pred as well as on COPD.Results A total of 1876 women aged 40 years and above were enrolled with mean age of(62.1±8.2)years old,among them,78.1%were menopausal,and 40.9%had been pregnant≥3 times.Multivariate analysis showed that FVC and FEV1 decreased in postmenopausal women,but menopause was not associated with a decrease in their percentage of predicted values.Pregnancies≥3 times was a risk factor for COPD(for 3 times,OR=4.92,95%CI:1.48-19.95,P<0.05;for≥4 times,OR=9.06,95%CI:2.32-41.57,P<0.01),while pregnancies of 2 times did not increase the risk of COPD.Conclusion In women aged 40 years and above,menopause is associated with poorer FVC and FEV1,and excessive pregnancy(≥3 times)is a risk factor for COPD.

Objective To explore the evidence,urinary biomarkers,and partial mechanisms of hypercoagulability in the pathogenesis of IgA vasculitis(IgAV).Methods Differential expression of proteins in the urine of 10 healthy children and 10 children with IgAV was screened using high-performance liquid chromatography-tandem mass spectrometry,followed by Reactome pathway analysis.Protein-protein interaction(PPI)network analysis was conducted using STRING and Cytoscape software.In the validation cohort,15 healthy children and 25 children with IgAV were included,and the expression levels of differential urinary proteins were verified using enzyme-linked immunosorbent assay.Results A total of 772 differential proteins were identified between the IgAV group and the control group,with 768 upregulated and 4 downregulated.Reactome pathway enrichment results showed that neutrophil degranulation,platelet activation,and hemostasis pathways were involved in the pathogenesis of IgAV.Among the differential proteins,macrophage migration inhibitory factor(MIF)played a significant role in neutrophil degranulation and hemostasis,while thrombin was a key protein in platelet activation and hemostasis pathways.PPI analysis indicated that thrombin directly interacted with several proteins involved in inflammatory responses,and these interactions involved MIF.Validation results showed that compared to healthy children,children with IgAV had significantly higher urine thrombin/creatinine and urine MIF/creatinine levels(P<0.05).Conclusions Thrombin contributes to the pathogenesis of IgAV through interactions with inflammatory factors.Urinary thrombin and MIF can serve as biomarkers reflecting the hypercoagulable and inflammatory states in children with IgAV.

Objective:To investigate the correlation of peripheral blood T lymphocyte subsets with overall survival(OS)and clinical baseline characteristics in mantle cell lymphoma(MCL).Methods:The clinical data of 55 MCL patients who were newly diagnosed in the Department of Hematology,Second Hospital of Shanxi Medical University from January 2012 to July 2022 were analyzed retrospectively.The percentages of T lymphocyte subsets and CD4+/CD8+ratio in peripheral blood were detected by flow cytometry,and their correlation with clinical characteristics of patients were analyzed.Kaplan-Meier method was used for survival analysis and survival curves were drawn.Log-rank test was used for univariate analysis,while Cox proportional hazards model was used for multivariate analysis.Results:The median follow-up was 40(1-68)months,and the median overall survival(OS)was 47 months.Among the 55 patients,30(54.5％)patients had a decrease in peripheral blood CD4+T lymphocyte,while 17(30.9％)patients had a increase in peripheral blood CD8+T lymphocyte,and 20(36.4％)patients had a decrease in CD4+/CD8+ratio.There were no significant correlations between CD4+/CD8+ratio and sex,age,Ki-67,B symptoms,leukocytes,hemoglobin,lymphocytes,platelets,albumin,lactate dehydrogenase(LDH),β2-microglobulin,splenomegaly,bone marrow invasion,primary site and MIPI score.Survival analysis showed that patients with CD4+T cell＞23.3％,CD8+Tcell ≤33.4％and CD4+/CD8+ratio＞0.6 had longer OS(P=0.020,P＜0.001,P＜0.001).Univariate analysis showed that Ki-67＞30％,LDH＞250 U/L,splenomegaly,bone marrow involvement,CD4+T cells 23.3％,CD8+T cells＞33.4％,CD4+/CD8+ratio ≤0.6 were adverse prognostic factors affecting OS of MCL patients.Multivariate analysis showed that CD4+/CD8+ratio ≤0.6(HR=4.382,P=0.005)was an independent adverse prognostic factor for OS of MCL patients.Conclusions:Low CD4+/CD8+ratio is associated with poor prognosis in MCL,and the CD4+/CD8+ratio can be used as an important indicator to evaluate the prognosis risk in MCL patients.

Aim To explore the improvement effect of Bazi Bushen capsule on thymic degeneration in SAMP6 mice and the possible mechanism.Methods Twenty 12 week old male SAMP6 mice were randomly divided into the model group(SAMP6)and the Bazi Busheng capsule treatment group(SAMP6+BZBS).Ten SAMR1 mice were assigned to a homologous control group(SAMR1).The SAMP6+BZBS group was oral-ly administered Bazi Bushen capsule suspension(2.8 g·kg-1)daily,while the other two groups were orally administered an equal amount of distilled water.After nine weeks of administration,the morphology of the thymus in each group was observed and the thymus in-dex was calculated;HE staining was used to observe the structural changes of thymus tissue;SA-β-gal stai-ning was used to detect thymic aging;flow cytometry was used to detect the proportion of thymic CD3+T cells in each group;Western blot was used to detect the levels of p16,Bax,Bcl-2,and cleaved caspase-3 proteins in thymus;immunofluorescence was applied to detect the proportion of cortical thymic epithelial cells in each group;ELISA was employed to detect IL-7 lev-els in thymus.Results Compared with the SAMP6 group,the thymic index of the SAMP6+BZBS group significantly increased(P＜0.05);the disordered thy-mic structure was significantly improved;the positive proportion of SA-β-gal staining significantly decreased(P＜0.01);the proportion of CD3+T cells apparently increased(P＜0.05);the level of p16 protein signifi-cantly decreased(P＜0.05);the level of Bcl-2 pro-tein significantly increased(P＜0.05),while the lev-el of cleaved caspase-3 protein markedly decreased(P＜0.05);the proportion of cortical thymic epithelial cells evidently increased;the level of IL-7 significantly increased(P＜0.01).Conclusions Bazi Bushen capsule can delay thymic degeneration,inhibit cell ap-optosis in thymus and promote thymic cell development in SAMP6 mice,which may be related to increasing the proportion of cortical thymic epithelial cells and promoting IL-7 secretion.