1.Long-term Outcomes of Endoscopic Radiofrequency Ablation versus Endoscopic Submucosal Dissection for Widespread Superficial Esophageal Squamous Cell Neoplasia
Xin TANG ; Qian-Qian MENG ; Ye GAO ; Chu-Ting YU ; Yan-Rong ZHANG ; Yan BIAN ; Jin-Fang XU ; Lei XIN ; Wei WANG ; Han LIN ; Luo-Wei WANG
Gut and Liver 2025;19(2):198-206
Background/Aims:
Endoscopic radiofrequency ablation (ERFA) is a treatment option for superficial esophageal squamous cell neoplasia (ESCN), with a relatively low risk of stenosis; however, the long-term outcomes remain unclear. We aimed to compare the long-term outcomes of patients with widespread superficial ESCN who underwent endoscopic submucosal dissection (ESD) or ERFA.
Methods:
We retrospectively analyzed the clinical data of patients with superficial ESCN who underwent ESD or ERFA between January 2015 and December 2021. The primary outcome measure was recurrence-free survival.
Results:
Ninety-two and 33 patients with superficial ESCN underwent ESD and ERFA, respectively. The en bloc, R0, and curative resection rates for ESD were 100.0%, 90.2%, and 76.1%, respectively. At 12 months, the complete response rate was comparable between the two groups (94.6% vs 90.9%, p=0.748). During a median follow-up of 66 months, recurrence-free survival was significantly longer in the ESD group than in the ERFA group (p=0.004), while no significant differences in overall survival (p=0.845) and disease-specific survival (p=0.494) were observed.Preoperative diagnosis of intramucosal cancer (adjusted hazard ratio, 5.55; vs high-grade intraepithelial neoplasia) was an independent predictor of recurrence. Significantly fewer patients in the ERFA group experienced stenosis compare to ESD group (15.2% vs 38.0%, p=0.016).
Conclusions
The risk of recurrence was higher for ERFA than ESD for ESCN but overall survival was not affected. The risk of esophageal stenosis was significantly lower for patients who underwent ERFA.
2.Exploring the safety and the countermeasures of rational use of Psoraleae Fructus based on the evolution of efficacy/toxicity records in ancient and modern literature
Ying-jie XU ; Xiao-yan ZHAN ; Zhao-fang BAI ; Xiao-he XIAO
Acta Pharmaceutica Sinica 2025;60(2):314-322
Psoraleae Fructus is derived from the dried fruit of the
3.Analysis of characteristics of adverse drug reactions in a hospital from 2021 to 2023
Yan WANG ; Ming FANG ; Hongwei SONG ; Chao ZHONG ; Feng XU ; Ting ZHOU
Journal of Pharmaceutical Practice and Service 2025;43(4):200-204
Objective To analyze the characteristics of adverse drug reactions (ADR) reported in Sixth People’s Hospital South Campus, Shanghai Jiaotong University from 2021 to 2023, to provide reference for promoting rational clinical drug use. Methods ADR data reported in our hospital were collected retrospectively, including patients’ basic information, drugs causing adverse reactions, types of adverse reactions and outcomes. Descriptive analysis methods were used to summarize and analyze the data. Results A total of 979 cases of ADR were reported in our hospital from 2021 to 2023. The highest proportion of patients with ADR occurred in the age range of 31 to 50, and more male patients (63.5%). The top five drugs involved with adverse reactions were antibiotics (48.8%), Chinese medicine injections(19.2%), vitamins(7.5%), Chinese traditional medicine(7.2%), equine tetanus immunoglobulin(6.3%). Among antibiotics, cefuroxime, ceftazidime and cefotiam were the majority. The organs/systems involved in all ADR were mainly skin and accessories damage (55.4%). The clinical manifestations were rash, itching, and maculopapular rash. Conclusion From 2021 to 2023, the most common drugs causing adverse drug reactions in our hospital were mainly antibacterial drugs, and the rational clinical use of antibacterial drugs still needs to be concerned.
4.Long-term Outcomes of Endoscopic Radiofrequency Ablation versus Endoscopic Submucosal Dissection for Widespread Superficial Esophageal Squamous Cell Neoplasia
Xin TANG ; Qian-Qian MENG ; Ye GAO ; Chu-Ting YU ; Yan-Rong ZHANG ; Yan BIAN ; Jin-Fang XU ; Lei XIN ; Wei WANG ; Han LIN ; Luo-Wei WANG
Gut and Liver 2025;19(2):198-206
Background/Aims:
Endoscopic radiofrequency ablation (ERFA) is a treatment option for superficial esophageal squamous cell neoplasia (ESCN), with a relatively low risk of stenosis; however, the long-term outcomes remain unclear. We aimed to compare the long-term outcomes of patients with widespread superficial ESCN who underwent endoscopic submucosal dissection (ESD) or ERFA.
Methods:
We retrospectively analyzed the clinical data of patients with superficial ESCN who underwent ESD or ERFA between January 2015 and December 2021. The primary outcome measure was recurrence-free survival.
Results:
Ninety-two and 33 patients with superficial ESCN underwent ESD and ERFA, respectively. The en bloc, R0, and curative resection rates for ESD were 100.0%, 90.2%, and 76.1%, respectively. At 12 months, the complete response rate was comparable between the two groups (94.6% vs 90.9%, p=0.748). During a median follow-up of 66 months, recurrence-free survival was significantly longer in the ESD group than in the ERFA group (p=0.004), while no significant differences in overall survival (p=0.845) and disease-specific survival (p=0.494) were observed.Preoperative diagnosis of intramucosal cancer (adjusted hazard ratio, 5.55; vs high-grade intraepithelial neoplasia) was an independent predictor of recurrence. Significantly fewer patients in the ERFA group experienced stenosis compare to ESD group (15.2% vs 38.0%, p=0.016).
Conclusions
The risk of recurrence was higher for ERFA than ESD for ESCN but overall survival was not affected. The risk of esophageal stenosis was significantly lower for patients who underwent ERFA.
5.Long-term Outcomes of Endoscopic Radiofrequency Ablation versus Endoscopic Submucosal Dissection for Widespread Superficial Esophageal Squamous Cell Neoplasia
Xin TANG ; Qian-Qian MENG ; Ye GAO ; Chu-Ting YU ; Yan-Rong ZHANG ; Yan BIAN ; Jin-Fang XU ; Lei XIN ; Wei WANG ; Han LIN ; Luo-Wei WANG
Gut and Liver 2025;19(2):198-206
Background/Aims:
Endoscopic radiofrequency ablation (ERFA) is a treatment option for superficial esophageal squamous cell neoplasia (ESCN), with a relatively low risk of stenosis; however, the long-term outcomes remain unclear. We aimed to compare the long-term outcomes of patients with widespread superficial ESCN who underwent endoscopic submucosal dissection (ESD) or ERFA.
Methods:
We retrospectively analyzed the clinical data of patients with superficial ESCN who underwent ESD or ERFA between January 2015 and December 2021. The primary outcome measure was recurrence-free survival.
Results:
Ninety-two and 33 patients with superficial ESCN underwent ESD and ERFA, respectively. The en bloc, R0, and curative resection rates for ESD were 100.0%, 90.2%, and 76.1%, respectively. At 12 months, the complete response rate was comparable between the two groups (94.6% vs 90.9%, p=0.748). During a median follow-up of 66 months, recurrence-free survival was significantly longer in the ESD group than in the ERFA group (p=0.004), while no significant differences in overall survival (p=0.845) and disease-specific survival (p=0.494) were observed.Preoperative diagnosis of intramucosal cancer (adjusted hazard ratio, 5.55; vs high-grade intraepithelial neoplasia) was an independent predictor of recurrence. Significantly fewer patients in the ERFA group experienced stenosis compare to ESD group (15.2% vs 38.0%, p=0.016).
Conclusions
The risk of recurrence was higher for ERFA than ESD for ESCN but overall survival was not affected. The risk of esophageal stenosis was significantly lower for patients who underwent ERFA.
6.Long-term Outcomes of Endoscopic Radiofrequency Ablation versus Endoscopic Submucosal Dissection for Widespread Superficial Esophageal Squamous Cell Neoplasia
Xin TANG ; Qian-Qian MENG ; Ye GAO ; Chu-Ting YU ; Yan-Rong ZHANG ; Yan BIAN ; Jin-Fang XU ; Lei XIN ; Wei WANG ; Han LIN ; Luo-Wei WANG
Gut and Liver 2025;19(2):198-206
Background/Aims:
Endoscopic radiofrequency ablation (ERFA) is a treatment option for superficial esophageal squamous cell neoplasia (ESCN), with a relatively low risk of stenosis; however, the long-term outcomes remain unclear. We aimed to compare the long-term outcomes of patients with widespread superficial ESCN who underwent endoscopic submucosal dissection (ESD) or ERFA.
Methods:
We retrospectively analyzed the clinical data of patients with superficial ESCN who underwent ESD or ERFA between January 2015 and December 2021. The primary outcome measure was recurrence-free survival.
Results:
Ninety-two and 33 patients with superficial ESCN underwent ESD and ERFA, respectively. The en bloc, R0, and curative resection rates for ESD were 100.0%, 90.2%, and 76.1%, respectively. At 12 months, the complete response rate was comparable between the two groups (94.6% vs 90.9%, p=0.748). During a median follow-up of 66 months, recurrence-free survival was significantly longer in the ESD group than in the ERFA group (p=0.004), while no significant differences in overall survival (p=0.845) and disease-specific survival (p=0.494) were observed.Preoperative diagnosis of intramucosal cancer (adjusted hazard ratio, 5.55; vs high-grade intraepithelial neoplasia) was an independent predictor of recurrence. Significantly fewer patients in the ERFA group experienced stenosis compare to ESD group (15.2% vs 38.0%, p=0.016).
Conclusions
The risk of recurrence was higher for ERFA than ESD for ESCN but overall survival was not affected. The risk of esophageal stenosis was significantly lower for patients who underwent ERFA.
7.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.
8.Iodine nutritional status of children aged 8-10 in Wuhan from 2019 to 2023
WANG Shuai, CHEN Fang, YANG Yan, LUO Huatang, LIU Cong, XU Wenxiu
Chinese Journal of School Health 2025;46(6):792-796
Objective:
To explore the iodine nutrition status of children in Wuhan from 2019 to 2023, and to evaluate the effect of iodine deficiency disorders control in focus groups in Wuhan, so as to provide a basis for consolidating elimination of iodine deficiency disorders.
Methods:
A total of 13 000 non boarding primary school students aged 8-10 were selected from 13 districts of Wuhan by stratified random sampling method.Household salt samples were collected to measure salt iodine content, random urine samples were analyzed for urinary iodine concentration. And B ultrasound was used to measure thyroid volume in students. The median of salt iodine, coverage rate of iodized salt, consumption rate of qualified iodized salt, median of urinary iodine, and the goiter rate were calculated. And Mann-Whitney U- test, Kruskal-Wallis H- test and Chi-square test were applied to compare between groups. Chi-square trend test was used to analyze the changing trends of coverage rate of iodized salt, consumption rate of qualified iodized salt and goiter rate among children in Wuhan.
Results:
The median of iodine content of children s household salt was 23.8 (21.7, 26.1) mg/kg, and the coverage rate of iodized salt was 98.7%, and the consumption rate of qualified iodized salt was 94.5 %. The consumption rates of qualified iodized salt showed an overall upward trend from 2019 to 2023 ( χ 2 trend =5.57, P <0.05). The median of urinary iodine of children was 220.1 (136.7, 326.0) μg/L,and boys had higher median of urinary iodine than girls [228.3(143.2, 336.0),210.2(129.1, 315.7) μg/L] ( Z =6.60, P <0.01). The median of urinary iodine of children in suburbs was higher than those in urban areas [236.3 (150.7, 342.2) , 207.1 (124.5, 309.8) μg/L]( Z =11.00, P <0.01). A total of 4 600 children were examined for thyroid volume, and the range of goiter rates were 1.1% to 3.4%, with an average goiter rate of 2.5%, which showed an overall downward trend from 2019 to 2023 ( χ 2 trend =5.11, P <0.05).
Conclusions
The iodine nutrition is sufficient and iodine nutrition status is good among children in Wuhan. It should continue to carry out monitoring and evaluation of children s iodine nutrition, guide the public to supplement iodine scientifically,so as to maintain the appropriate level of iodine for children.
9.Potential utility of albumin-bilirubin and body mass index-based logistic model to predict survival outcome in non-small cell lung cancer with liver metastasis treated with immune checkpoint inhibitors.
Lianxi SONG ; Qinqin XU ; Ting ZHONG ; Wenhuan GUO ; Shaoding LIN ; Wenjuan JIANG ; Zhan WANG ; Li DENG ; Zhe HUANG ; Haoyue QIN ; Huan YAN ; Xing ZHANG ; Fan TONG ; Ruiguang ZHANG ; Zhaoyi LIU ; Lin ZHANG ; Xiaorong DONG ; Ting LI ; Chao FANG ; Xue CHEN ; Jun DENG ; Jing WANG ; Nong YANG ; Liang ZENG ; Yongchang ZHANG
Chinese Medical Journal 2025;138(4):478-480
10.Current status of generalized pustular psoriasis: Findings from a multicenter hospital-based survey of 127 Chinese patients.
Haimeng WANG ; Jiaming XU ; Xiaoling YU ; Siyu HAO ; Xueqin CHEN ; Bin PENG ; Xiaona LI ; Ping WANG ; Chaoyang MIAO ; Jinzhu GUO ; Qingjie HU ; Zhonglan SU ; Sheng WANG ; Chen YU ; Qingmiao SUN ; Minkuo ZHANG ; Bin YANG ; Yuzhen LI ; Zhiqiang SONG ; Songmei GENG ; Aijun CHEN ; Zigang XU ; Chunlei ZHANG ; Qianjin LU ; Yan LU ; Xian JIANG ; Gang WANG ; Hong FANG ; Qing SUN ; Jie LIU ; Hongzhong JIN
Chinese Medical Journal 2025;138(8):953-961
BACKGROUND:
Generalized pustular psoriasis (GPP), a rare and recurrent autoinflammatory disease, imposes a substantial burden on patients and society. Awareness of GPP in China remains limited.
METHODS:
This cross-sectional survey, conducted between September 2021 and May 2023 across 14 hospitals in China, included GPP patients of all ages and disease phases. Data collected encompassed demographics, clinical characteristics, economic impact, disease severity, quality of life, and treatment-related complications. Risk factors for GPP recurrence were analyzed.
RESULTS:
Among 127 patients (female/male ratio = 1.35:1), the mean age of disease onset was 25 years (1st quartile [Q1]-3rd quartile [Q3]: 11-44 years); 29.2% had experienced GPP for more than 10 years. Recurrence occurred in 75.6% of patients, and nearly half reported no identifiable triggers. Younger age at disease onset ( P = 0.021) and transitioning to plaque psoriasis ( P = 0.022) were associated with higher recurrence rates. The median diagnostic delay was 8 months (Q1-Q3: 2-41 months), and 32.3% of patients reported misdiagnoses. Comorbidities were present in 53.5% of patients, whereas 51.1% experienced systemic complications during treatment. Depression and anxiety affected 84.5% and 95.6% of patients, respectively. During GPP flares, the median Dermatology Life Quality Index score was 19.0 (Q1-Q3: 13.0-23.5). This score showed significant differences between patients with and without systemic symptoms; it demonstrated correlations with both depression and anxiety scores. Treatment costs caused financial hardship in 55.9% of patients, underscoring the burden associated with GPP.
CONCLUSIONS
The substantial disease and economic burdens among Chinese GPP patients warrant increased attention. Patients with early onset disease and those transitioning to plaque psoriasis require targeted interventions to mitigate the high recurrence risk.
Humans
;
Male
;
Female
;
Psoriasis/pathology*
;
Adult
;
Cross-Sectional Studies
;
Adolescent
;
Child
;
Young Adult
;
Quality of Life
;
Middle Aged
;
China/epidemiology*
;
Recurrence
;
Risk Factors
;
Surveys and Questionnaires
;
East Asian People


Result Analysis
Print
Save
E-mail