Objective To analyse MMACHC mutations for 45 pedigrees with combined methylmalonic aciduria and homocyctinuria by Sanger sequencing, and to discuss the utility of prenatal genetic diagnosis for these pedigrees.Method Peripheral blood was collected from 45 probands and their parents from 2012-2015 in Genetic Counselling Clinic of the First Affiliated Hospital of Zhengzhou University, and the DNA were extracted from the blood.Then the coding sequence of MMACHC gene was amplified by PCR, and the PCR products were further sequenced to detect mutations for each pedigree.For 12 families, chorionic villus sampling was performed on the pregnant women to make prenatal genetic diagnosis.Result There were 14 distinct mutations detected in the 45 pedigrees, and the most frequent mutations are c.609G>A(W203X),c.658-660delAAG(K220del)and c.80A>G (Q27A).Two of those mutations have not been reported before:one is a splicing site mutation c.81+1G>A;while the other is a missense mutation c.665A>G,p.Y222C.Most mutations were found in exon 4.Among the 12 pedigrees who received prenatal diagnosis, 2 fetuses were normal, 7 fetuses were carriers of heterozygous mutation, and the other 3 fetuses were patients with compound heterozygous mutation or homozygous mutation.The couples whose fetuses were normal or carriers continued the gestation, while the couples whose fetuses were patients decided to terminate the pregnancy.After delivery, the outcome of the fetuses was the same as the prenatal diagnose results.Conclusion Two novel mutations of MMACHC were identified and prenatal genetic diagnosis helps to avoid the delivery of combined methylmalonic aciduria and homocyctinuria patients.

Objective To investigate the prevalence and incidence of Keshan disease (KD) and the selenium concentration of food and hair in residents of Yongjin Village, Fuyu County, Heilongjiang Province, national monitoring site, in 2007. Methods According to the Standard of Keshan Disease Surveillance and the Standard of Diagnosis of Keshan Disease(GB 17021-1997), the residents living in the monitoring site were surveyed by clinical examination and electrocardiography. For individuals whose hearts showed abnormalities, a chest X-ray photograph was taken. The selenium concentrations of the residents' food (flour) and hair were assayed by flowing injection hydride generation atomic fluoremetric method(FI-HG-AFM). Results Nineteen KD patients were found from 282 residents in 2007 KD surveillance. The prevalence of KD, latent KD and chronic KD were 6.7%(19/282), 2.8%(8/282) and 3.9%(11/282), respectively. Five of the 8 latent KD cases were newly found. In addition, there were 5 the suspected KD cases, including 2 suspected chronic KD cases. No acute KD or sub-acute KD patients were found in Yongjin Village at this monitoring site this year. The average selenium concentration of children hair and residents food were (0.3197±0.0586)mg/kg and (0.0210±0.0062)mg/kg, respectively. Conclusions New cases of KD continued to emerge, indicating that etiological factors still exist. Therefore, the emphasis of monitoring KD in furore is founding the consummate report of infectious disease system and training the personnel to increase the reliability of monitoring.

The aim of this study was to explore the characteristics of Toll-like receptor expression in mesenchymal stem cells derived from bone marrow of healthy donor (BM-MSCs). BM-MSCs were isolated from bone marrow of healthy donor by Ficoll method. Expressions of CD34, CD45, HLA-DR, CD44 and CD71 in BM-MSCs were detected by flow cytometry. CD71 in BM-MSCs was assayed by immunocytochemistry. The adipocyte and osteoblast induction of BM-MSCs were detected by alizarin red stain and oil red stain respectively. TLR 1 - 10 mRNA levels in BM-MSCs were evaluated by semiquantitative RT-PCR. The results showed that expressions of CD34, CD45 and HLA-DR in BM-MSC were negative while the expressions of CD44 and CD71 were positive. CD71 in BM-MSCs was positive. After induced by osteoblast and adipocyte inductor, BM-MSCs were positive for alizarin red staining and oil red staining respectively. All of TLR 1 - 10 mRNA were found in BM-MSCs with high expression levels of TLR2, TLR3, TLR4, TLR7, TLR8, TLR9 and low expression levels of TLR1, TLR5, TLR6, TLR10. In conclusion, different levels of TLR 1 - 10 mRNA were expressed in BM-MSCs of healthy donor.
Bone Marrow Cells ; metabolism ; Cell Differentiation ; Cells, Cultured ; Humans ; Mesenchymal Stromal Cells ; metabolism ; RNA, Messenger ; genetics ; Toll-Like Receptors ; metabolism

To investigate the role of the extracellular signal-regulated kinase (ERK1/2) and PI3K/AKT/ mTOR signal pathway inducing bone marrow mesenchymal stem cells (BMSCs) differentiation into neural cells, mouse bone marrow-derived mesenchymal stem cell lines D1 cells were used as research object. And they were divided into control groups and salidroside (SD) groups. Different concentrations (5, 25, 50, 100 and 200 microg x mL(-1) of SD were used and SD (100 microg x mL(-1)) was used to induce at different time (0.5, 1, 3, 6, 9, 12, 24, 48 and 72 h). The immunofluorescence staining chemical technology, real-time PCR and Western blotting were used to detect the positive rates of NSE, MAP2, beta-Tubulin III, NES, GFAP and the expression levels of beta-Tubulin III, NSE, ERK1/2, AKT. The expression of ERK1/2 and NSE was detected when the ERK1/2 and PI3K/AKT/ mTOR signal pathway was blocked by PD98059 and LY294002. It indicated that the positive rates of NSE, MAP2, beta-Tubulin III, NES and GFAP were gradually enhanced with time increased. The expression level of NSE and beta-Tubulin III protein were significantly higher than those in control groups (P < 0.01). The expression of ERK1/2, AKT mRNA and protein were higher with concentration and time increased. When the ERK1/2 and PI3K/AKT/mTOR signal pathway were blocked, the expression levels of NSE, NES and beta-Tubulin III mRNA and NSE protein were inhibited significantly. It points out that SD can stimulate the ERK1/2 and PI3K/AKT/mTOR signal pathway to promote BMSCs differentiation into neural cells.
Animals ; Bone Marrow Cells ; cytology ; Cell Differentiation ; drug effects ; Cells, Cultured ; Chromones ; pharmacology ; Enzyme Inhibitors ; pharmacology ; Flavonoids ; pharmacology ; Glial Fibrillary Acidic Protein ; metabolism ; Glucosides ; antagonists & inhibitors ; isolation & purification ; pharmacology ; MAP Kinase Signaling System ; drug effects ; Mesenchymal Stromal Cells ; cytology ; Mice ; Microtubule-Associated Proteins ; metabolism ; Mitogen-Activated Protein Kinase 1 ; genetics ; metabolism ; Mitogen-Activated Protein Kinase 3 ; genetics ; metabolism ; Morpholines ; pharmacology ; Nestin ; metabolism ; Neurons ; cytology ; metabolism ; Phenols ; antagonists & inhibitors ; isolation & purification ; pharmacology ; Phosphatidylinositol 3-Kinases ; metabolism ; Phosphopyruvate Hydratase ; genetics ; metabolism ; Plants, Medicinal ; chemistry ; Protein Kinase Inhibitors ; pharmacology ; Proto-Oncogene Proteins c-akt ; genetics ; metabolism ; RNA, Messenger ; metabolism ; Rhodiola ; chemistry ; Signal Transduction ; drug effects ; TOR Serine-Threonine Kinases ; metabolism ; Tubulin ; metabolism

Objective To investigate the regulatory actions of Intestines-unblocking, Turbid-purging Recipe (ITR) on colonic 5-hydroxytryptamine (5-HT) and its receptor 5-hydroxytryptamine 3 (5-HT3) in rats with constipation-dominant irritable bowel syndrome (IBS-C), and to explore the therapeutic mechanism of ITR in treating IBS-C. Methods Forty-two male SD rats were randomly divided into 6 groups, namely normal group, model group, western medicine group, high-, middle- and low-dose Chinese medicine groups, 7 rats in each group. IBS-C rat model was established by intragastric administration of ice water. After establishment of the model, western medicine group was given intragastric administration of Cisapride Tablets (at the dosage of 3.6 mg·kg-1·d-1), Chinese medicine groups were given intragastric administration of various dosages of ITR granules (18.5, 9.25, 4.625 g·kg-1·d-1 respectively) , and the model group was given intragastric administration of normal saline, the treatment lasting 14 d. The rats in various groups were given normal feeding and drinking. After treatment, HE staining method was used to observe pathological changes in the intestinal tissue, immunohistochemistry method was used to observe the expression levels of intestinal 5-HT and 5-HT3 receptor. Results Compared with the normal group, the expression level of rat intestinal 5-HT was increased (P < 0.05) and that of 5-HT3 receptor was decreased (P < 0.05) in the model group and the medication groups. Compared with the model group, 5-HT expression level was decreased significantly (P<0.05) and 5-HT3 receptor expression level was increased (P < 0.05) in the medication groups, and the improvement of the middle-dose Chinese medicine group was more obvious (P < 0.05). Conclusion ITR has therapeutic efficacy for IBS-C rats through lowering 5-HT expression and increasing 5-HT3 receptor expression, which results into the improvement of intestinal sensitivity and abnormal dynamic of the rats.

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

This study was aimed to explore the effects of peptidoglycan (PGN) on proliferation and cell cycle of human bone marrow mesenchymal stem cells (MSCs). MSCs were isolated from human bone marrow by density gradient centrifugation. The purity of MSCs with the spindle fibroblastic morphology was identified by microphotography and the phenotypes were detected by flow cytometry (FCM). MSCs incubated with different doses of PGN (1, 10, 20 μg/ml) were used as test groups, and those incubated without PGN were regarded as control group. The isolated and cultured MSCs were inoculated into 96-well plates according to a certain concentration. Cell cycle was measured by flow cytometry after incubated with PGN for 72 hours. The results showed that the cell proliferation index was significantly increased in dose and time dependent manners after MSCs was incubated with PGN. Its effects on the proliferation of MSCs were highest in 10 μg/ml group. Compared with the control group, PGN could significantly decrease proportion of MSCs in G₀/G₁ phase and increase them in S and G₂/M phases (p < 0.05). It is concluded that PGN can promote more MSCs to enter the DNA synthesis phase and proliferate many much MSCs in dose and time dependent manners.
Bone Marrow Cells ; cytology ; Cell Cycle ; drug effects ; Cell Proliferation ; drug effects ; Cells, Cultured ; Flow Cytometry ; Humans ; Mesenchymal Stromal Cells ; cytology ; Peptidoglycan ; pharmacology ; Toll-Like Receptor 2

Objective To compare aortic root anatomical characteristics between severe aortic valve stenosis (AS) and aortic regurgitation (AR) patients, and to provide useful information for transcatheter aortic valve replacement (TAVR) device designs and procedural techniques for treatment of AR. Methods Consecutive patients admitted between April 2014 to May 2016 with severe AS or AR and planned to undergo transcatheter aortic valve replacement were included. There were a total of 57 AR and 113 AS patients. All patients underwent multi-detector computed tomographic imaging and echocardiography examinations. Results The mean aortic annulus diameter in AR patients was slightly but significantly larger than AS patients[ (26.4±3.7) mm vs. (25.2±2.9) mm, P=0.001]. The mean diameters of the ascending aorta[ (38.3±6.9) mm vs. (33.9±6.7) mm, P<0.001]and Valsalva sinus[ (38.9±6.9) mm vs. (32.7±4.5) mm, P<0.001] in AR patients were larger than in AS patients. The left coronary ostia height was of no significant difference between the 2 groups [ (12.5±3.7) mm vs. (13.4±3.2) mm, P=0.08] and the right coronary ostia height was higher in the AR group than in the AS group [ (17.5±5.0) mm vs. (15.3±3.3) mm, P=0.001]. Conclusions The anatomical aortic root data from patients with AS or AR in the present study may provide useful information for transcatheter aortic valve replacement device designs and procedural techniques for treatment of AR.

BACKGROUND: Cell-free stem cell therapy has been an issue of concern, but there is no conclusion on how to extract high-quality exosomes. OBJECTIVE: To extract exosomes from human umbilical cord mesenchymal stem cells by using three different methods, and then to screen the optimal method. METHODS: Exosomes were extracted from human umbilical cord mesenchymal stem cells by using the Total Exosome Isolation test kit, Exo Quick test kit and differential ultracentrifugation method, respectively. Then, transmission electron microscopy was used for morphological observations, BCA was utilized to quantify the protein, and western blot assay was applied to detect surface markers CD9, CD81 and CD63. RESULTS AND CONCLUSION: Extraction of exosomes was completed by all the three methods, and round or oval membranous vesicles were observed under the transmission electron microscope. The protein content and purity of exosomes was highest in the differential ultracentrifugation group, followed by the Exobiology Quick kit group, and lowest in the Total Exosome Isolation kit group, and there were significant differences among the three groups (P < 0.05). Under the same protein concentration, surface specific markers, CD81, CD63 and CD9, were expressed highest in the differential ultracentrifugation group, followed by the Exobiology Quick kit group, and lowest in the Total Exosome Isolation kit group. The operating time was significantly lower in the Exobiology Quick kit group compared with the other two groups (P < 0.05). To conclude, despite a longer operating time, the differential ultracentrifugation method is a rational method to extract enough exosomes with relative high purity.

Objective :To analyze influence of probucol combined atorvastatin on hemodynamics and blood lipids in patients with large artery cerebral infarction (LACI).Methods :A total of 92 LACI patients were randomly and e-qually divided into atorvastatin group and combined treatment group (received atorvastatin combined probucol ) , both groups were treated for six months .Therapeutic effect etc indexes before and after treatment were compared between two groups .Results :Compared with atorvastatin group after six-month treatment ,there were significant reductions in levels of TC [ (4.57 ± 0.82) mmol/L vs.(3.23 ± 0.71) mmol/L] ,TG [ (1.37 ± 0.45) mmol/L vs. (1.02 ± 0.34) mmol/L] ,LDL-C [ (2.52 ± 0.83) mmol/L vs .(1.50 ± 0.54) mmol/L] ,oxidized low density lipo-protein [ox-LDL ,(78.36 ± 14.05) mg/L vs.(58.37 ± 12.00) mg/L] ,left and right middle cerebral artery pulsatili-ty index (PI) [left :(0.84 ± 0.25) vs.(0.74 ± 0.14) ,right :(0.84 ± 0.23) vs.(0.74 ± 0.16)] and inflammatory factors ,and significant rise in total effective rate (69.57% vs.89.13% P＝0.020) ,left and right middle cerebral systolic blood flow velocity (Vs) [left :(87.45 ± 15.58) cm/s vs.(95.48 ± 18.34) cm/s ,right :(89.27 ± 14.36) cm/s vs.(96.18 ± 14.03) cm/s] and mean blood flow velocity (Vm) [left :(60.90 ± 16.19) cm/s vs .(76.19 ± 17.40) cm/s ,right :(62.08 ± 17.23) cm/s vs .(91.38 ± 19.26) cm/s] in combined treatment group ,P＜0.05 or ＜0.01. There was no significant difference in drug adverse reactions incidence rate between two groups , P＝1. 000 .Conclu-sion :Therapeutic effect of probucol combined atorvastatin is significantly better than that of pure atorvastatin on large artery cerebral infarction .It can more significantly improve blood lipids and intracranial artery hemodynamics with anti-inflammatory effects .