Adult ; Aged ; Aged, 80 and over ; Anti-Infective Agents ; pharmacology ; therapeutic use ; Cross Infection ; drug therapy ; microbiology ; Female ; Hospitalization ; Humans ; Inpatients ; Male ; Middle Aged ; Pneumoconiosis ; microbiology ; Pneumonia ; drug therapy ; microbiology ; Retrospective Studies

This paper mainly introduces the design, structure and software of the pulse condition meter. It's suggested that Chinese Traditional Medicine be developed into a preeminent one in the world.

Shanghai University of TCM was the first Chinese medicine university that established field-grade experimental teaching center in China.And both of the Chinese medicine and Chinese herbs experimental teaching centers became national experimental teaching demonstration centers.There is general improvement in laboratories conditions,so the experimental teaching team building is the critical factor of improving experimental teaching quality.The experimental teaching team of Shanghai University of TCM consists of excellent teachers as its backbone,and lecturers and technicians from fields in traditional Chinese medicine Chinese herbs and clinical practices.The team members cooperate with each other by setting up experimental teaching research groups to improve teaching quality,which plays an important role in building experimental teaching demonstration center.

Objective To study the pathological features and developmental tendency of gastric carcinoma(GC) in Wuwei City. Methods The clinical data of 7346 cases of GC found in 85427 cases undergoing endoscopy in Wuwei City from 1977 to 2000 were retrospectively analysed. Results The detectation rate of GC by endoscopy in Wuwei City was 8.7%. GC developed to a peak at 40～70 years of age(92.0%).In the GC cases, the Hp infection rate was 64.6%, which is higher than that in the area of low incidence of GC and the general population. Hp infection rate in poorly differentiated adenocarcinoma was higher than that in well differenciated type.Most GC(43.8%) were located in the proximal portion of the stomach. Poorly differentiated adenocarcinoma appeared to be the most common pathological type. Conclusions GC in Wuwei City is related to Hp infection. GC location has shifted from the distal to the proximal portion of the stomach in the last 23 years.

OBJECTIVETo evaluate target-controlled infusion (TCI) of remifentail-propofol and the balanced anesthesia of fentanyl-isoflurane during the operation with suspension laryngscope.

METHODSSixty ASA I-II patients scheduled for the surgery through suspension laryngoscopy were randomly divided into two groups: TCI group and control group. In TCI group, anesthesia was maintained with TCI remifentanil-propofol which was stopped at the end of operation. The target plasma concentration of remifentanil was set at 6 microg/L and propofol at 3 mg/L. In control group, anesthesia was induced with intravenous fentanl 2.5 microg/kg and propofol 1-2 mg/kg, maintained with fentanl 0.03 microg.kg(-1). min(-1) and 1% isoflurane which was stopped at the end of surgery. Intubation was facilitated with succinylcholine 1-1.5 mg/kg.MAP, HR, ECG, S(p)O(2) and P(ET)CO(2) were monitored during anesthesia. The following parameters were recorded and compared between two groups: (1) the changes in blood pressure (BP), heart rate(HR) and S(p)O(2) at different time point; (2) recovery profile including the time of response to verbal commands, autonomous breathing, tracheal extubation, orientation recovery, discharging from PACU after operation; (3) OAAS scores after operation; (4) postoperative complications; (5) unexpected events and awareness during operation.

RESULT(1) The hemodynamics were stable while the target plasma concentration of remifentanil was set at 6 microg/L and propofol at 3 mg/L. (2) During tracheal intubation, suspension laryngoscope was inserted, and extubation MAP was significantly lower in TCI group than that in control group; (3) There were no significant differences in hemodynamic values and S(p)O(2) of different time points between two groups. Study group was faster than control group on recovery profile including the time of response to verbal commands, autonomous breathing, tracheal extubation, orientation recovery and discharging from PACU. There was respectively one unexpected event in both groups.

CONCLUSIONRemifentanil supplemented with isoflurane anesthesia can achieve the optimal hemodynamic stability during the operation with suspension laryngoscopy and better recovery profile from anesthesia than fentanyl.

Adolescent ; Adult ; Anesthetics, Combined ; administration & dosage ; Anesthetics, Intravenous ; administration & dosage ; Blood Pressure ; Female ; Heart Rate ; Humans ; Laryngoscopy ; methods ; Male ; Middle Aged ; Piperidines ; administration & dosage ; Propofol ; administration & dosage

OBJECTIVETo investigate the changes in expression profiles of angiomotin (Amot), schlafen5 (Slfn5), metalloproteinase-9 (MMP-9) and vascular endothelial cell growth factor (VEGF), which are genes associated with angiogenesis, tumor growth and invasion, after gene silencing of pleiotrophin (PTN) in human small cell lung cancer H446 cells.

METHODSPTN expression in H446 cells was determined by RT-PCR and Western blot. After constructing a lentiviral vector interfering PTN expression, it was packaged into virus in 293T cells. Then the virus was used to infect human small cell lung cancer H446 cells. The expressions of Amot, Slfn5, MMP-9 and VEGF were detected by RT-PCR in normal non-interference group, negative control group, PTN-interference group and group combining PTN interference and chemotherapy.

RESULTSThe results of RT-PCR and Western blot test showed that PTN expression in H446 cells was high. The interference efficiency of constructed ShRNA sequences (GCAGCTGTGGATACTGCTGAA) targeting PTN was as high as 72.1% and 59.2% at the mRNA and protein levels, respectively, in H446 cells. Compared with the negative control group, the expressions of Slfn5 and MMP-9 in H446 cells were increased by 165.1% and 47.3%, while the ones of Amot and VEGF were down-regulated by 33.1% and 26.6%, respectively, after gene silencing of PTN. The changes of gene expression profile became more evident when chemotherapy was superimposed on PTN interference.

CONCLUSIONGene silencing of PTN using siRNA lentiviral expressing vector can influence the expression of proliferation and metastasis-related genes in human small cell lung cancer H446 cells.

Carrier Proteins ; genetics ; metabolism ; Cell Cycle Proteins ; metabolism ; Cell Line, Tumor ; Cytokines ; genetics ; metabolism ; Gene Expression Profiling ; Gene Expression Regulation, Neoplastic ; Genetic Vectors ; Humans ; Intercellular Signaling Peptides and Proteins ; metabolism ; Lentivirus ; genetics ; Lung Neoplasms ; genetics ; metabolism ; pathology ; Matrix Metalloproteinase 9 ; metabolism ; Membrane Proteins ; metabolism ; RNA Interference ; RNA, Messenger ; metabolism ; RNA, Small Interfering ; genetics ; Small Cell Lung Carcinoma ; genetics ; metabolism ; pathology ; Vascular Endothelial Growth Factor A ; metabolism

Cardiac Catheterization ; Heart Septal Defects, Ventricular ; therapy ; Humans ; Prosthesis Implantation ; instrumentation ; Septal Occluder Device

OBJECTIVETo explore immunoregulatory mechanism of mesenchymal stem cells (MSCs) in H-2 haploidentical bone marrow cells transplantation mice.

METHODSBALB/c female mice irradiated with 8Gy 60Co gamma-rays were divided into two groups: MSCs group, infused cm-DiI labeled MSCs from female CB6F1 mice and monocytes from the bone marrow and spleen of male CB6F1; Control group, only infused monocytes from the bone marrow and spleen of male CB6F1. T-lymphocyte subpopulation of peripheral blood cells, T and B cells proliferation stimulated by ConA and LPS, mixed lymphocyte reaction between donor and recipient and third part, the sry-gene chimerism of bone marrow, spleen and thymus of the recipient, the distribution of MSCs in the recipient, the incidence rate of GVHD and survival were observed.

RESULTSThe CD3 at +90 d the percent of CD3+ CD4+ cells, and CD4/CD8 at +30 d in the MSCs group were higher than that in control post-transplantation, respectively (P < 0.05). The proliferation activity of B cells recovered more rapidly and that of T cells recovered comparably in MSCs group as compared with that in control group. The result of MLR between donor and recipient was lower in MSCs group than that in the control; and that between recipient and the third part had no difference. The sry-gene chimerism of bone marrow and spleen of the recipient was higher in MSCs group than in control at +30 d. The MSCs mainly distributed in intestine, thymus, bone marrow, liver, heart of the recipient after transplantation. The incidence of acute GVHD was higher and the survival rate was lower in MSCs group than that in control group (P < 0.05). Chronic GVHD occurred in the control group at +90 d, while in the MSCs group at +120 d.

CONCLUSIONSMSCs might improve stem cell engraftment, promote lymphocyte and humoral immunity recovery, decrease incidence of GVHD and increase survival by inducing specific immunologic tolerance and repairing organs injuries.

Animals ; Bone Marrow Cells ; immunology ; Bone Marrow Transplantation ; immunology ; Female ; Graft vs Host Disease ; immunology ; Male ; Mesenchymal Stromal Cells ; immunology ; Mice ; Mice, Inbred BALB C

The aim of this study was to investigate the effect of mesenchymal stem cells (MSCs) on cell cycle and apoptosis of thymus, spleen and bone marrow cells in mice totally irradiated with sublethal dose, and to explore its mechanisms. BALB/c mice irradiated with 5.5 Gy 60Co gamma-ray were randomly divided into control group and MSC group. Mice in MSC group were infused with 0.4 ml containing 2.5x10(7)/kg of MSCs through tail vein at 1 hour after irradiation. Mice in control group were infused with 0.4 ml normal saline. The cell apoptosis and cell cycle of thymus, spleen and bone marrow cells were detected by flow cytometry at 6, 12, 24 and 72 hours after irradiation and the P53 protein expressions in thymus and bone marrow cells were assayed by immunohistochemistry at 12 hours after irradiation. The results showed that the arrest of cells in G0/G1 and G2/M phase, and decrease of cells in S phase appeared at 6 hours after irradiation, those reached peak respectively at 12 hours in thymus cells, 6 hours in spleen and 24 hours in bone marrow, then the cell counts in G0/G1 phase decreased and the cell counts in S and G2/M phases increased. At 72 hours the cell counts in G0/G1 phase were less than the normal level and the cell counts in S phase were more than the normal level. The above changes of cell cycle in thymus and spleen were more rapid in spleen and more obvious in amplitude than that in bone marrow, the change of cell cycle in MSC group was more rapid and obvious than those in control group. After irradiation the apoptosis cells increased from 6 hours, reached the highest level at 12 hours and decreased to the normal level gradually after 24 hours in two groups; the apoptosis rates in spleen and thymus cells were higher than that in bone marrow cells. In comparison with the control group, the apoptosis rate in thymus cells at 12 hours, in spleen cells at 12 and 24 hours, and in bone marrow cells at 24 hours were fewer in MSC group. The cells expressing P53 protein in control group were more than that in MSC group. It is concluded that the MSCs accelerate the running of cell cycle in these hematopoietic tissue cells of irradiated mice, reduce the cell apoptosis and promote the recovery from injuries in hematopietic and immunological organs, thus protect the irradiated mice at early stage.
Animals ; Apoptosis ; physiology ; Bone Marrow Cells ; pathology ; Cell Cycle ; Female ; Mesenchymal Stem Cell Transplantation ; Mice ; Mice, Inbred BALB C ; Radiation Injuries, Experimental ; pathology ; therapy ; Random Allocation ; Spleen ; pathology ; Thymus Gland ; pathology ; Whole-Body Irradiation

OBJECTIVETo explore the effect of Chinese materia medica on immune intervention of infantile recurrent respiratory tract infection.

METHODThirty-one children of recurrent respiratory tract infection were randomly divided into two groups: therapy group was treated with oral Chinese materia medica (b. i. d), control group was only treated with oral carboxymethyl liquor (< 4 years, 3 mL; 4-7 years, 5 mL; > 7 years, 7 mL, t. i. d). The change of IL-12,TNF-alpha, IL-6, IL-13, IL-6 and IL-4 in different time were observed and analyzes.

RESULTCompared with the control group, the level of IL-12 and IL-2 was significantly increased after treatment of oral Chinese materia medica (P < 0.01), however, the level of TNF-alpha, IL-13, IL-4, and IL-6 was decreased after treatment (P < 0.01). During one years follow-up study, the frequency of respiratory infection every year of therapy group was significantly decreased than that of control group.

CONCLUSIONChinese materia medica could prevent infantile recurrent respiratory tract infection effectively, increase humoral immunity function and ensure normal growth in children.

Adolescent ; Child ; Child, Preschool ; Female ; Humans ; Immunotherapy ; methods ; Infant ; Infant, Newborn ; Male ; Materia Medica ; therapeutic use ; Recurrence ; Respiratory Tract Infections ; therapy