OBJECTIVETo observe effect of formula of removing both phlegm and blood stasis (TYTZ) in improving hemorheology and blood fat of mini-swine with coronary heart disease of phlegm-stasis cementation syndrome.

METHODThirty-six Chinese mini-swine were randomly divided to six groups: the normal control group, the model group, the Shujiangzhi group and TYTZ groups with doses of 2.0, 1.0 and 0.5 g x kg(-1), with six mice in each group. Except for the normal control group, all of other groups were fed with high-fat diet for 2 weeks. Interventional balloons are adopted to injure their left anterior descending artery endothelium. After the operation, they were fed with high-fat diet for 8 weeks to prepare the coronary heart disease model of phlegm-stasis cementation syndrome. In the 8th week after the operation and administration, the changes in hemorheological parameters, serum lipid level, myocardial ischemia level and range were observed.

RESULTCompared with the normal control group, the model group showed significant increase in serum TC, TG, LDL-C and VLDL-C levels (P < 0.01), whole blood viscosity under the shear rate of 5 s (-1) and 60 s (-1) (P < 0.01), and myocardial ischemia degree and range (P < 0.01). Compared with the model group, TYTZ groups revealed significant decrease in myocardial ischemia degree and range (P < 0.01), serum TC, TG, LDL-C and VLDL-C levels (P < 0.05 or P < 0.01) and whole blood viscosity under the shear rate of 5 s(-1) and 60 s(-1) (P < 0.05).

CONCLUSIONTYTZ could improve the abnormal hemorheology in Chinese mini-swine with coronary heart disease of phlegm-stasis cementation syndrome, and regulate serum lipid, with a certain efficacy for coronary heart disease of phlegm-stasis cementation syndrome.

Animals ; Coronary Disease ; blood ; metabolism ; physiopathology ; therapy ; Female ; Hemorheology ; Lipids ; blood ; Male ; Medicine, Chinese Traditional ; methods ; Mucous Membrane ; secretion ; Swine ; Swine, Miniature

OBJECTIVETo observe the effect of formula of removing both phlegm and blood stasis (TYTZ) in inhibiting the inflammatory reaction in Chinese mini-swine with coronary atherosclerosis.

METHODTotally 36 Chinese mini-swine were randomly divided to six groups: the normal control group, the model group, the Shujiangzhi group and TYTZ groups with does of 2.0, 1.0 and 0.5 g x kg(-1), and six each in every group. Except for the normal control group, all of other groups were fed with high-fat diet for 2 weeks. Interventional balloons are adopted to injure their left anterior descending artery endothelium. After the operation, they were fed with high-fat diet for 8 weeks to prepare the coronary atherosclerosis model. In the 8th week after the operation and administration, the intravascular ultrasound was adopted to observe the coronary artery plaque burden of each group and the pathological morphology of coronary artery. Such inflammatory factors as high-sensitivity C-reactive protein (hs-CRP), tumor necrosis factor (TNF)-alpha and interleukin (IL)-6 were detected by ELISA. The expression of NF-kappaB p65 nuclear translocation was observed by the immunohistochemical method.

RESULTCompared with the normal control group, the model group showed significant increase in the coronary artery plaque burden at the end of the experiment (P < 0.01), notably abnormal structural changes in atherosclerotic vascular tissues, luminal stenosis, a large number of foam cells and inflammatory cell infiltration, remarkable growth of hs-CRP, TNF-alpha and IL-6 levels (P < 0.01). The immunohistochemical staining also showed the significant increase in the NF-kappaB p65 nuclear translocation of coronary artery of Chinese mini-swine in the model group. Compared with the model group, TYTZ could significantly attenuate atherosclerotic plaque burden (P < 0.01), inhibit the coronary luminal stenosis, reduce inflammatory cell infiltration, decrease such inflammatory cell factors as hs-CRP, TNF-alpha and IL-6 in serum, and inhibit the NF-kappaB p65 nuclear translocation of coronary artery (P < 0.05 or P < 0.01).

CONCLUSIONTYTZ can reduce the downstream inflammatory reaction by controlling NF-kappaB p65 nuclear translocation, so as to inhibit the occurrence and development of coronary atherosclerotic plaque in Chinese mini-swine.

Animals ; C-Reactive Protein ; metabolism ; Coronary Artery Disease ; blood ; complications ; drug therapy ; pathology ; Female ; Inflammation ; complications ; Interleukin-6 ; blood ; Male ; Medicine, Chinese Traditional ; methods ; Mucous Membrane ; drug effects ; secretion ; Swine ; Swine, Miniature ; Tumor Necrosis Factor-alpha ; blood

OBJECTIVETo analyze and summarize changes of syndrome-related biological indices in acute lacuna encephalon infarction patients of upper hyperactivity of Gan yang syndrome (UHGYS), thus providing objective evidence for syndrome typing and disease identification.

METHODSRecruited were 50 patients at Department of Encephalopathy, Xiyuan Hospital, China Academy of Chinese Medical Sciences, who were in line with diagnostic criteria of UHGYS as the experimental group in this study. Another 40 healthy volunteers were recruited as the control group from May 2010 to July 2012. Blood routines (including WBC, RBC, Hb, NEUT%, and LY%), hepatic and renal functions tests (including ALT, AST, TBIL, TP, ALB, Cr, and BUN) were performed by automatic whole blood analyzer and colorimetric technique. The levels of fasting blood glucose, HbAlc, blood lipids (including TC, TG, HDL-C, LDL-C, and VLDL-C), and coagulation functions (including AT-III, PT, PTA, INR, TT, APTT, and FBG, reaction time), renin, angiotensin II, hs-CRP, and Hcy were also measured. The thyroid functions (including FT3, FT4, T3, T4, and TSH) were detected by electrochemiluminescence immunoassay. The levels of tumor necrosis factor alpha (TNF-alpha), IL-6 and IL-1 in serum were measured by ELISA and radioimmunoassay respectively.

RESULTSCompared with the control group, RBC, LY%, ALT, TP, ALB, HDL-C, AT-III activities, contents of PTA and FT4 obviously decreased, TBIL, BUN, Glu, HbAlc, TSH, hs-CRP, renin, Ang II, TNF-alpha, IL-1 and IL-6 significantly increased in the experimental group (P < 0.05, P < 0.01).

CONCLUSIONThe pathological process of acute lacuna encephalon infarction patients of UHGYS was closely correlated with thyroid functions, the renin-angiotensin-aldosterone system, the extrinsic and intrinsic coagulation systems, as well as inflammation reaction.

Acute Disease ; Adult ; Case-Control Studies ; Female ; Humans ; Infarction ; blood ; diagnosis ; Male ; Medicine, Chinese Traditional ; Middle Aged ; Stroke, Lacunar ; blood ; diagnosis

OBJECTIVETo explore the effects of Tongxinluo capsule (TXL) on the atherosclerosis obliterans (ASO) in iliofemoral artery of rabbits.

METHODRabbits were randomly divided into 7 groups: sham, model, TXL (0.8, 0.4, 0.2 g x kg(-1)), Tongsaimai tablet (0.8 g x kg(-1)) and Laishike (0.002 g x kg(-1)). The animal model of ASO was established with a combined method of mechanical trauma, immunologic injury and high fat fodder feeding. Rabbits were administrated the drugs 8 weeks after surgery. The levels of TC, TG, HDL-C and LDL-C in serum were determined at the time points below: pre-experiment (0 week), pre-drug administration (8 weeks post-surgery), 4 weeks after drug administration (12 weeks post-surgery), 8 weeks after drug administration (16 weeks post-surgery), 12 weeks after drug administration (20 weeks post-surgery). Meanwhile, the behavioral study was performed, the distal skin temperature of the injured hind limb detected. The histopathological changes in iliofemoral artery were examined after opacification.

RESULTThe levels of TC, TG, LDL-C, VLDL-C and TC/HDL-C were decreased significantly in serum of ASO rabbits. The severity of lameness in the injured hind limb was improved. The distal skin temperature was increased. The thickness and the ratio of intima area of the iliofemoral artery of the injured hind limb were decreased, while the stenosis extent was improved.

CONCLUSIONTXL might be beneficial to modulate blood lipid, as well as the prevention and treatment for ASO.

Animals ; Arteriosclerosis Obliterans ; blood ; pathology ; prevention & control ; Arthropods ; chemistry ; Behavior, Animal ; drug effects ; Capsules ; Cholesterol ; blood ; Cholesterol, HDL ; blood ; Cholesterol, LDL ; blood ; Drug Combinations ; Drugs, Chinese Herbal ; administration & dosage ; isolation & purification ; pharmacology ; Femoral Artery ; drug effects ; pathology ; Iliac Artery ; drug effects ; pathology ; Male ; Materia Medica ; administration & dosage ; isolation & purification ; pharmacology ; Plants, Medicinal ; chemistry ; Rabbits ; Random Allocation ; Triglycerides ; blood ; Tunica Intima ; drug effects ; pathology

Cardiac Catheterization ; Heart Septal Defects, Ventricular ; therapy ; Humans ; Prosthesis Implantation ; instrumentation ; Septal Occluder Device

OBJECTIVETo investigate the changes in expression profiles of angiomotin (Amot), schlafen5 (Slfn5), metalloproteinase-9 (MMP-9) and vascular endothelial cell growth factor (VEGF), which are genes associated with angiogenesis, tumor growth and invasion, after gene silencing of pleiotrophin (PTN) in human small cell lung cancer H446 cells.

METHODSPTN expression in H446 cells was determined by RT-PCR and Western blot. After constructing a lentiviral vector interfering PTN expression, it was packaged into virus in 293T cells. Then the virus was used to infect human small cell lung cancer H446 cells. The expressions of Amot, Slfn5, MMP-9 and VEGF were detected by RT-PCR in normal non-interference group, negative control group, PTN-interference group and group combining PTN interference and chemotherapy.

RESULTSThe results of RT-PCR and Western blot test showed that PTN expression in H446 cells was high. The interference efficiency of constructed ShRNA sequences (GCAGCTGTGGATACTGCTGAA) targeting PTN was as high as 72.1% and 59.2% at the mRNA and protein levels, respectively, in H446 cells. Compared with the negative control group, the expressions of Slfn5 and MMP-9 in H446 cells were increased by 165.1% and 47.3%, while the ones of Amot and VEGF were down-regulated by 33.1% and 26.6%, respectively, after gene silencing of PTN. The changes of gene expression profile became more evident when chemotherapy was superimposed on PTN interference.

CONCLUSIONGene silencing of PTN using siRNA lentiviral expressing vector can influence the expression of proliferation and metastasis-related genes in human small cell lung cancer H446 cells.

Carrier Proteins ; genetics ; metabolism ; Cell Cycle Proteins ; metabolism ; Cell Line, Tumor ; Cytokines ; genetics ; metabolism ; Gene Expression Profiling ; Gene Expression Regulation, Neoplastic ; Genetic Vectors ; Humans ; Intercellular Signaling Peptides and Proteins ; metabolism ; Lentivirus ; genetics ; Lung Neoplasms ; genetics ; metabolism ; pathology ; Matrix Metalloproteinase 9 ; metabolism ; Membrane Proteins ; metabolism ; RNA Interference ; RNA, Messenger ; metabolism ; RNA, Small Interfering ; genetics ; Small Cell Lung Carcinoma ; genetics ; metabolism ; pathology ; Vascular Endothelial Growth Factor A ; metabolism

OBJECTIVETo evaluate target-controlled infusion (TCI) of remifentail-propofol and the balanced anesthesia of fentanyl-isoflurane during the operation with suspension laryngscope.

METHODSSixty ASA I-II patients scheduled for the surgery through suspension laryngoscopy were randomly divided into two groups: TCI group and control group. In TCI group, anesthesia was maintained with TCI remifentanil-propofol which was stopped at the end of operation. The target plasma concentration of remifentanil was set at 6 microg/L and propofol at 3 mg/L. In control group, anesthesia was induced with intravenous fentanl 2.5 microg/kg and propofol 1-2 mg/kg, maintained with fentanl 0.03 microg.kg(-1). min(-1) and 1% isoflurane which was stopped at the end of surgery. Intubation was facilitated with succinylcholine 1-1.5 mg/kg.MAP, HR, ECG, S(p)O(2) and P(ET)CO(2) were monitored during anesthesia. The following parameters were recorded and compared between two groups: (1) the changes in blood pressure (BP), heart rate(HR) and S(p)O(2) at different time point; (2) recovery profile including the time of response to verbal commands, autonomous breathing, tracheal extubation, orientation recovery, discharging from PACU after operation; (3) OAAS scores after operation; (4) postoperative complications; (5) unexpected events and awareness during operation.

RESULT(1) The hemodynamics were stable while the target plasma concentration of remifentanil was set at 6 microg/L and propofol at 3 mg/L. (2) During tracheal intubation, suspension laryngoscope was inserted, and extubation MAP was significantly lower in TCI group than that in control group; (3) There were no significant differences in hemodynamic values and S(p)O(2) of different time points between two groups. Study group was faster than control group on recovery profile including the time of response to verbal commands, autonomous breathing, tracheal extubation, orientation recovery and discharging from PACU. There was respectively one unexpected event in both groups.

CONCLUSIONRemifentanil supplemented with isoflurane anesthesia can achieve the optimal hemodynamic stability during the operation with suspension laryngoscopy and better recovery profile from anesthesia than fentanyl.

Adolescent ; Adult ; Anesthetics, Combined ; administration & dosage ; Anesthetics, Intravenous ; administration & dosage ; Blood Pressure ; Female ; Heart Rate ; Humans ; Laryngoscopy ; methods ; Male ; Middle Aged ; Piperidines ; administration & dosage ; Propofol ; administration & dosage

OBJECTIVETo analyze the clinicopathological characteristics and prognosis of a rare histological type of esophageal cancer-sarcomatoid carcinoma.

METHODSClinicopathological data of 31 patients with esophageal sarcomatoid carcinoma who underwent surgery in the Department of Thoracic Surgery of Zhejiang Cancer Hospital from Jan 2000 to Dec 2009 were collected and analyzed. The survival analysis was performed using Kaplan-Meier method.

RESULTSAll the patients underwent surgery. Of the 31 patients, one received preoperative chemoradiotherapy and postoperative chemotherapy, and 8 received postoperative chemotherapy. All the tumors were located in the middle or lower esophagus. Microscopically, the tumors were composed of both carcinomatous and sarcomatous components, and there was a transition between the two components, but no obvious heterogenous elements such as osteosarcoma, chondrosarcoma or rhabdomyosarcoma were found. In the carcinomatous components, positive expression of CK and EMA was found in all the 31 cases, and positive expression of vimentin in 5 of the 31 cases. In the sarcomatous components, positive expression of CK, EMA and vimentin was found in 29, 28 and 23 cases, respectively. The 1-, 3-, and 5-year survival rates were 80.6%, 55.9% and 33.4%, respectively, and the median survival time was 40 months.

CONCLUSIONSEsophageal sarcomatoid carcinoma is a particular type of esophageal malignancy with unique clinicopathological features. The diversity and complexity of the carcinomatous and sarcomatous components and their potential of transformation and differentiation lead to different prognosis from each other.

Adult ; Aged ; Aged, 80 and over ; Antineoplastic Combined Chemotherapy Protocols ; therapeutic use ; Carcinosarcoma ; metabolism ; pathology ; surgery ; therapy ; Chemoradiotherapy, Adjuvant ; Chemotherapy, Adjuvant ; Esophageal Neoplasms ; metabolism ; pathology ; surgery ; therapy ; Esophagectomy ; methods ; Female ; Follow-Up Studies ; Humans ; Keratins ; metabolism ; Male ; Middle Aged ; Mucin-1 ; metabolism ; Prognosis ; Survival Rate ; Vimentin ; metabolism

OBJECTIVETo investigate the cardio-protective effects of Corocalm on acute myocardial ischemia in rats, and to explore its possible therapeutic mechanisms.

METHODSThe acute ischemic model was prepared by ligating the left anterior descending (LAD) coronary artery in rats. The animals were divided into 6 groups, 8 in each group. The sham operated group underwent heart exposure without ligation and were treated with normal saline 3 ml/kg, while the other 5 groups, the model groups, consisted of acceptable acute ischemic model rats and were also treated with normal saline, with the Guanxin Capsule (GXC) group treated with refined GXC, 600 mg/kg, the low and high dose Corocalm groups treated with 85 mg/kg and 340 mg/kg of Corocalm respectively, and the Diltiazem group, treated with Diltiazem 5 mg/kg, with all the tested drugs prepared with normal saline into equal volume (3 ml/kg) and administrated once via duodenum 10 min before ligation. Myocardial infarction area was determined by the quantitative histological assay with nitroblue tetrazolium (N-BT) stain. And the levels of creatine phosphokinase (CK), lactate dehydrogenase (LDH), malondialdehyde (MDA) content, and the activity of superoxide dismutase (SOD) in serum were measured by biochemical assay and spectrophotometry respectively. Besides, the blood viscosity in another 50 rats was determined, who received for 7 successive days oral administration with different concentration of Corocalm or aspirin.

RESULTSIt showed that low and high dose Corocalm could significantly reduce the infarction area, inhibit the increase of serum CK, LDH activity and MDA content, and enhance the SOD activity after ischemia/reperfusion. The whole blood viscosity at different shear rates in rats treated with high dose Corocalm was significantly lower than those treated with normal saline (P < 0.05).

CONCLUSIONCorocalm has favourable protective effects on heart in ischemic condition, the effect of which might be through its actions in inhibiting CK and LDH activity, scavenging oxygen free radicals, and lowering blood viscosity.

Acute Disease ; Animals ; Blood Viscosity ; drug effects ; Cardiotonic Agents ; pharmacology ; Creatine Kinase ; blood ; Drugs, Chinese Herbal ; pharmacology ; L-Lactate Dehydrogenase ; blood ; Male ; Malondialdehyde ; blood ; Myocardial Infarction ; drug therapy ; metabolism ; pathology ; Myocardial Reperfusion Injury ; drug therapy ; metabolism ; pathology ; Rats ; Rats, Wistar ; Reactive Oxygen Species ; metabolism ; Superoxide Dismutase ; blood

OBJECTIVETo investigate the effects and the related mechanisms of the components of Dang-Gui-Bu-Xue decoction (DGBXD) on improving blood deficiency.

METHODThe effects of promoting hematopoietic function were observed with the blood difficient model mice, by giving components of DGBXD. RBC, WBC, reticulocytes and bone marrow nucleated cells (BMNC) were determined. The components of DGBXD on proliferation of BMNC and on clony forming unit (CFU) were also determined.

RESULTThe components of DGBXD remarkably increased the quantity of RBC, WBC, and BMNC. Some of the components promoted the proliferation of BMNC and increased the quantity of CFU-Mix. Among them, polysaccharide of angelica was most potent.

CONCLUSIONThe studies show that the extracts and some components of DGBXD can promote the hemopoietic function system of the model mice, and they exert the effects in a comprehensive way.

Angelica sinensis ; chemistry ; Animals ; Astragalus membranaceus ; chemistry ; Blood Cell Count ; Bone Marrow Cells ; drug effects ; Colony-Forming Units Assay ; Drug Combinations ; Drugs, Chinese Herbal ; pharmacology ; Female ; Hematopoietic Stem Cells ; drug effects ; Male ; Mice ; Mice, Inbred BALB C ; Mice, Inbred ICR ; Phytotherapy ; Plant Extracts ; pharmacology ; Plants, Medicinal ; chemistry ; Polysaccharides ; isolation & purification ; pharmacology