1.Survey on the perception and current status of drug risk management in medical institutions
Xuelin SUN ; Mingqing XING ; Zixuan ZHANG ; Wenjing ZHAO ; Dongfang QIAN ; Yan LIANG ; Li XU ; Pengfei JIN ; Yatong ZHANG
China Pharmacy 2025;36(1):7-12
OBJECTIVE To know about the perception and current status of drug risk management among pharmacists in Chinese medical institutions, providing insights and recommendations for enhancing the drug risk management system in medical institutions. METHODS A questionnaire survey was conducted across 28 provinces, cities, and autonomous regions; stratified radom sampling was employed to study the population of medical workers and pharmaceutical professionals in medical institutions nationwide. The survey included information on the survey population, the current status of drug risk management implementation in medical institutions, the cognition, definition and process of drug risk management related concepts, and the content and mode of drug risk management work in medical institutions. Finally, suggestions were collected from various medical institutions on the system construction of drug risk management. Descriptive statistical analysis was adopted to summarize the obtained data. RESULTS A total of 446 questionnaires were collected in this survey, including 420 valid questionnaires and 26 invalid questionnaires. The questionnaire collection rate was 100%,and the effective rate was 94.17%. 51.19% of the respondents No.2020YFC2009001)。 based their understanding of drug risk management on Management Measures for Adverse Drug Reaction Reports and Monitoring, while 87.38% recognized the need for drug risk management throughout the drug use process. 63.33% of the participants stated that their medical institutions had dedicated positions related to drug risk management, with the highest proportion (72.17%) was in third-grade class A medical institutions. 66.43% reported implementing risk management across all drug use stages. Suggestions for the development of drug risk management systems in medical institutions by the research participants focused on enhancing guiding documents, clarifying concepts, establishing information-sharing mechanisms. CONCLUSIONS The overall awareness of drug risk management in China’s medical institutions is high, with practices in place across various stages in multiple forms. However, there remains a need to strengthen institutional documents, management regulations, system development, and information-sharing mechanisms to improve collaborative governance, improve drug management levels, and ensure patient safety.
2.Dynamics of eosinophil infiltration and microglia activation in brain tissues of mice infected with Angiostrongylus cantonensis
Fanna WEI ; Renjie ZHANG ; Yahong HU ; Xiaoyu QIN ; Yunhai GUO ; Xiaojin MO ; Yan LU ; Jiahui SUN ; Yan ZHOU ; Jiatian GUO ; Peng SONG ; Yanhong CHU ; Bin XU ; Ting ZHANG ; Yuchun CAI ; Muxin CHEN
Chinese Journal of Schistosomiasis Control 2025;37(2):163-175
Objective To investigate the changes in eosinophil counts and the activation of microglial cells in the brain tissues of mice at different stages of Angiostrongylus cantonensis infection, and to examine the role of microglia in regulating the progression of angiostrongyliasis and unravel the possible molecular mechanisms. Methods Fifty BALB/c mice were randomly divided into the control group and the 7-d, 14-d, 21-day and 25-d infection groups, of 10 mice in each group. All mice in infection groups were infected with 30 stage III A. cantonensis larvae by gavage, and animals in the control group was given an equal amount of physiological saline. Five mice were collected from each of infection groups on days 7, 14, 21 d and 25 d post-infection, and 5 mice were collected from the control group on the day of oral gavage. The general and focal functional impairment was scored using the Clark scoring method to assess the degree of mouse neurological impairment. Five mice from each of infection groups were sacrificed on days 7, 14, 21 d and 25 d post-infection, and 5 mice from the control group were sacrificed on the day of oral gavage. Mouse brain tissues were sampled, and the pathological changes of brain tissues were dynamically observed using hematoxylin and eosin (HE) staining. Immunofluorescence staining with eosinophilic cationic protein (ECP) and ionized calcium binding adaptor molecule 1 (Iba1) was used to assess the degree of eosinophil infiltration and the counts of microglial cells in mouse brain tissues in each group, and the morphological parameters of microglial cells (skeleton analysis and fractal analysis) were quantified by using Image J software to determine the morphological changes of microglial cells. In addition, the expression of M1 microglia markers Fcγ receptor III (Fcgr3), Fcγ receptor IIb (Fcgr2b) and CD86 antigen (Cd86), M2 microglia markers Arginase 1 (Arg1), macrophage mannose receptor C-type 1 (Mrc1), chitinase-like 3 (Chil3), and phagocytosis genes myeloid cell triggering receptor expressed on myeloid cells 2 (Trem2), CD68 antigen (Cd68), and apolipoprotein E (Apoe) was quantified using real-time quantitative reverse transcription PCR (RT-qPCR) assay in the mouse cerebral cortex of mice post-infection. Results A large number of A. cantonensis larvae were seen on the mouse meninges surface post-infection, and many neuronal nuclei were crumpled and deeply stained, with a large number of bleeding points in the meninges. The median Clark scores of mouse general functional impairment were 0 (interquartile range, 0), 0 (interquartile range, 0.5), 6 (interquartile range, 1.0), 14 (interquartile range, 8.5) points and 20 (interquartile range, 9.0) points in the control group and the 7-d, 14-d, 21-d and 25-d groups, respectively (H = 22.45, P < 0.01), and the median Clark scores of mouse focal functional impairment were 0 (interquartile range, 0), 2 (interquartile range, 2.5), 7 (interquartile range, 3.0), 18 (interquartile range, 5.0) points and 25 (interquartile range, 6.5) points in the control group and the 7-d, 14-d, 21-d and 25-d groups, respectively (H = 22.72, P < 0.01). The mean scores of mice general and focal functional impairment were all higher in the infection groups than in the control group (all P values < 0.05). Immunofluorescence staining showed a significant difference in the eosinophil counts in mouse brain tissues among the five groups (F = 40.05, P < 0.000 1), and the eosinophil counts were significantly higher in mouse brain tissues in the 14-d (3.08 ± 0.78) and 21-d infection groups (5.97 ± 1.37) than in the control group (1.00 ± 0.28) (both P values < 0.05). Semi-quantitative analysis of microglia immunofluorescence showed a significant difference in the counts of microglial cells among the five groups (F = 17.66, P < 0.000 1), and higher Iba1 levels were detected in mouse brain tissues in 14-d (5.75 ± 1.28), 21-d (6.23 ± 1.89) and 25-d infection groups (3.70 ± 1.30) than in the control group (1.00 ± 0.30) (all P values < 0.05). Skeleton and fractal analyses showed that the branch length [(162.04 ± 34.10) μm vs. (395.37 ± 64.11) μm; t = 5.566, P < 0.05] and fractal dimension of microglial cells (1.30 ± 0.01 vs. 1.41 ± 0.03; t = 5.266, P < 0.05) were reduced in mouse brain tissues in the 21-d infection group relative to the control group. In addition, there were significant differences among the 5 groups in terms of M1 and M2 microglia markers Fcgr3 (F = 48.34, P < 0.05), Fcgr2b (F = 55.46, P < 0.05), Cd86 (F = 24.44, P < 0.05), Arg1 (F = 31.18, P < 0.05), Mrc1 (F = 15.42, P < 0.05) and Chil3 (F = 24.41, P < 0.05), as well as phagocytosis markers Trem2 (F = 21.19, P < 0.05), Cd68 (F = 43.95, P < 0.05) and Apoe (F = 7.12, P < 0.05) in mice brain tissues. Conclusions A. cantonensis infections may induce severe pathological injuries in mouse brain tissues that are characterized by massive eosinophil infiltration and persistent activation of microglia cells, thereby resulting in progressive deterioration of neurological functions.
3.Trend and influencing factors of low birth weight among newborns in Chongming District of Shanghai from 2008 to 2022
Aiyu SHI ; Tianyi GU ; Yan XU ; Yuhua HUANG ; Xiaolei SUN
Shanghai Journal of Preventive Medicine 2025;37(2):168-173
ObjectiveTo analyze the trend and influencing factors of low birth weight (LBW) among newborns in Chongming District of Shanghai from 2008 to 2022, so as to provide references for the development of intervention measures reducing the rate of LBW. MethodsBirth surveillance data of Chongming District of Shanghai from 2008 to 2022 were collected and organized, and the annual percentage change (APC) of LBW was calculated by using Joinpoint 5.0.2 software for trend change analysis. Logistic regression analysis was used to analyze the influencing factors of LBW. ResultsThe overall incidence of LBW was 3.71% in Chongming District, Shanghai from 2008 to 2022. Joinpoint trend analysis showed that the incidence of LBW in Chongming District had an upward trend (APC=5.49%, 95%CI: 3.31%‒7.72%, P<0.001).Multivariate logistic regression analysis showed that preterm birth, multiple births, female infants, birth defects, first pregnancy, primiparity, and a young father age (<20 years) were risk factors for LBW in Chongming District. Among the term infants, female infants, birth defects, and first pregnancy were risk factors for LBW (P<0.05). Female infants, birth defects, first pregnancy, primiparity, advanced maternal age (≥35 years), and a young father age (<20 years) were risk factors in singleton neonates. ConclusionThe incidence of LBW among newborns is on the rise in Chongming District of Shanghai. Therefore, high risk groups need to be identified, and prenatal check-ups and pregnancy care should be strengthened to reduce the risk of neonatal LBW.
4.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.
5.Multidimensional optimization strategies and practical effects of prescription pre-review system
Guangming GAO ; Tianjiao LIU ; Na XU ; Jing LIANG ; Xiangju SUN ; Zhanguo ZHU ; Hong YAN
China Pharmacy 2025;36(14):1797-1801
OBJECTIVE To optimize the prescription pre-review system in our hospital and evaluate its application effects. METHODS Aiming at the problems of imperfect rule base and high false positive rate in the early operation of the system, optimization measures were taken, including improving the content of the rule base, adjusting the interception level and prompt mode, refining the working model of prescription review pharmacists, and strengthening clinical communication. A retrospective cohort study was conducted, with prescription data from June to December 2023 (before optimization) as the control group and June to December 2024 (after optimization) as the observation group. Through inter group comparative analysis, the actual effect of optimizing the prescription pre-approval system was evaluated. RESULTS The prescription qualified rate increased from (82.51± 4.04)% before optimization to (90.98±1.55)% after optimization; the false positive rate decreased from (20.87±1.64)% before optimization to (7.41±2.04)% after optimization. The monthly range of prescription qualified rate narrowed from 10.24% to 4.11%, and the coefficient of variation decreased from 4.92% to 1.73%. The monthly range of false positive rate slightly increased from 4.40% to 5.34%, the coefficient of variation rose from 8.32% to 26.18%. CONCLUSIONS Through multi-dimensional optimizations of the prescription pre-review system in our hospital, its prescription review efficiency has been significantly enhanced, the quality of prescriptions has steadily improved, and the accuracy of reviews has notably improved.
6.Introduction to Implementation Science Theories, Models, and Frameworks
Lixin SUN ; Enying GONG ; Yishu LIU ; Dan WU ; Chunyuan LI ; Shiyu LU ; Maoyi TIAN ; Qian LONG ; Dong XU ; Lijing YAN
Medical Journal of Peking Union Medical College Hospital 2025;16(5):1332-1343
Implementation Science is an interdisciplinary field dedicated to systematically studying how to effectively translate evidence-based research findings into practical application and implementation. In the health-related context, it focuses on enhancing the efficiency and quality of healthcare services, thereby facilitating the transition from scientific evidence to real-world practice. This article elaborates on Theories, Models, and Frameworks (TMF) within health-related Implementation Science, clarifying their basic concepts and classifications, and discussing their roles in guiding implementation processes. Furthermore, it reviews and prospects current research from three aspects: the constituent elements of TMF, their practical applications, and future directions. Five representative frameworks are emphasized, including the Consolidated Framework for Implementation Research (CFIR), the Practical Robust Implementation and Sustainability Model (PRISM), the Exploration, Preparation, Implementation, Sustainment (EPIS)framework, the Behavior Change Wheel (BCW), and the Normalization Process Theory (NPT). Additionally, resources such as the Dissemination & Implementation Models Webtool and the T-CaST tool are introduced to assist researchers in selecting appropriate TMFs based on project-specific needs.
7.Influencing factors for the willingness to receive pneumococcal vaccine among middle-aged and elderly population in Zhejiang Province
XU Yanping ; YAN Xiaotong ; YAO Dingming ; XU Yue ; ZHANG Xuehai ; SUN Jie ; XU Jinhang
Journal of Preventive Medicine 2025;37(9):881-885
Objective:
To investigate the willingness to receive the pneumococcal vaccine and its influencing factors among middle-aged and elderly population in Zhejiang Province, so as to provide a basis for increasing the vaccination rate of pueumococcal among middle-aged and elderly population.
Methods:
From March to May 2024, a multi-stage random sampling method was employed to recruit residents aged ≥50 years from 35 counties (cities or districts) in Zhejiang Province. Data on basic information, knowledge of pneumonia, pneumococcal vaccine, and willingness to receive pneumococcal vaccine were collected through questionnaire surveys. A multivariable logistic regression model was used to analyze influencing factors for the willingness to receive pneumococcal vaccine among middle-aged and elderly population.
Results:
A total of 10 500 middle-aged and elderly population were surveyed. Among them, there were 5 202 males, accounting for 49.54%, and 5 298 females, accounting for 50.46%. The mean age was (65.11±9.05) years. Of the participants, 7 732 individuals were aware of pneumonia, accounting for 73.64%. A total of 1 724 individuals had received pneumococcal vaccine, corresponding to a vaccination rate of 16.42%. Furthermore, 5 138 participants expressed willingness to receive pneumococcal vaccine, with a willingness rate of 48.93%. The multivariable logistic regression analysis showed that middle-aged and elderly population aged ≥60 years (60-<70 years, OR=1.577, 95%CI: 1.433-1.736; ≥70 years, OR=2.110, 95%CI: 1.918-2.321), those with a history of chronic diseases (OR=1.250, 95%CI: 1.154-1.353), those who were recommended to receive the pneumonia vaccine by doctors (OR=4.896, 95%CI: 4.507-5.318), those who were aware of pneumonia (OR=1.460, 95%CI: 1.338-1.594), those who were aware that the elderly are prone to pneumonia (OR=1.490, 95%CI: 1.375-1.614), those who were aware of the causes of pneumonia (OR=1.559, 95%CI: 1.434-1.694), those who were aware that vaccination can prevent pneumonia (OR=2.196, 95%CI: 2.031-2.375), and those who were aware of the immunization schedule for pneumonia vaccine (OR=1.897, 95%CI: 1.683-2.124) had a higher willingness to receive pneumonia vaccine.
Conclusions
The willingness of middle-aged and elderly population in Zhejiang Province to receive pneumonia vaccine is related to age, history of chronic diseases, awareness of pneumonia, and awareness of pneumonia vaccine. It is recommended to strengthen health education on pneumonia and pneumonia vaccine for middle-aged and elderly population, in order to increase the willingness to receive the vaccine and vaccination rate.
8.Establishment of radioresistant NCI-H460 cells and investigation of their sensitivity to RSL-3
Di ZHAO ; Ying LI ; Xinyu ZHANG ; Xiaohui SUN ; Chang XU ; Qiang LIU ; Yan WANG
Chinese Journal of Radiological Health 2025;34(5):758-763
Objective To establish radioresistant human non-small cell lung cancer NCI-H460R model cells and evaluate the sensitivity of these radioresistant cells to a ferroptosis inducer. Methods Radioresistant cell lines, designated as NCI-H460 R20Gy and NCI-H460 R116Gy, were generated by subjecting parental NCI-H460 cells to fractionated irradiation with varying cumulative doses. Both parental cells and the established radioresistant cell lines were each randomly divided into four groups and exposed to irradiation at 0, 2, 4, and 6 Gy, respectively. Successful establishment of the radioresistant cell lines was confirmed by colony formation assay. Subsequently, cells were treated with increasing concentrations of the ferroptosis inducer RSL-3 to assess differential sensitivity between parental and radioresistant cells to ferroptosis. Results In comparison to the parental NCI-H460 cells (D0WT=1.2), both NCI-H460 R116Gy and NCI-H460 R20Gy cells exhibited radioresistance, with NCI-H460 R116Gy demonstrating a stronger radioresistance (D0R116Gy=1.5) than NCI-H460 R20Gy (D0R20Gy=1.4). Furthermore, NCI-H460 R116Gy cells exhibited increased sensitivity to RSL-3 relative to the parental cells (P < 0.001), while NCI-H460 R20Gy cells did not display a significant difference in sensitivity to RSL-3. Conclusion Human non-small cell lung cancer cells with radioresistance induced by a high cumulative irradiation dose exhibit increased sensitivity to the glutathione peroxidase 4-specific ferroptosis inducer RSL-3. This finding provides an experimental basis for optimizing combined treatment regimens involving radiotherapy and RSL-3 for non-small cell lung cancer patients with radiotherapy resistance.
9.Essential tremor plus affects disease prognosis: A longitudinal study.
Runcheng HE ; Mingqiang LI ; Xun ZHOU ; Lanqing LIU ; Zhenhua LIU ; Qian XU ; Jifeng GUO ; Xinxiang YAN ; Chunyu WANG ; Hainan ZHANG ; Irene X Y WU ; Beisha TANG ; Sheng ZENG ; Qiying SUN
Chinese Medical Journal 2025;138(1):117-119
10.Long-term efficacy of CMV/EBV bivirus-specific T cells for viral co-reactivation after stem cell transplantation.
Xuying PEI ; Meng LV ; Xiaodong MO ; Yuqian SUN ; Yuhong CHEN ; Chenhua YAN ; Yuanyuan ZHANG ; Lanping XU ; Yu WANG ; Xiaohui ZHANG ; Xiaojun HUANG ; Xiangyu ZHAO
Chinese Medical Journal 2025;138(5):607-609


Result Analysis
Print
Save
E-mail