1.An experimental study on changes of estrogen receptor in myocardium after acute myocardial infarction in rats
Lei XIANG ; Bin LUO ; Xinyao WU
Chinese Journal of Forensic Medicine 1986;0(02):-
Objective To investigate temporal expression of estrogen receptor (ER) in myocardium at non-infarct zone after acute myocardial infarction (AMI) in rats. Methods 120 healthy, male SD rats were randomly divided into three groups: control group, left anterior descending coronary artery (LAD) occlusion group and sham operation group with 8 rats in each group. The murine AMI-model was established by LAD ligation after anesthetization, and the rats in both LAD occlusion group and sham operation group were sacrificed at 2h, 4h, 8h, 12h, 1d, 2d, 4d, and 9d after occlusion. Myocardial samples were collected. H.E and ER immunohistochemical staining were performed. The results were quantitatively evaluated by image analysis system. The data were statistically analyzed with SPSS for Windows. Results ER expression in non-ischemic cardiomyocytes after LAD occlusion became more prominent with extension of LAD occlusion period. There was no significant difference within 12h after AMI, while ER expression was enhanced significantly 24h after ischemia. The enhancement were more evident from 4 to 9 days. Conclusion The results suggested that protective role may be initiated in response to acute ischemia in cardiac cells at non-infarct zone by increased ER expression after LAD occlusion in rats.
2.RFLPs ANALYSIS OF DIGOXIGENIN-LABELLED pAW101 PROBE AND ITS PRACTICAL USES
Chao LIU ; Chaoquan LUO ; Yinghao YANG ; Xinyao WU ; Jianyang LUO
Chinese Journal of Forensic Medicine 1987;0(03):-
A new method to revel RFLPs is presented. The human genomic DNAwas purified by saturatedNaCl solution and the pAW101 probe labelled with digoxigenin-dUTP. The relationships of RFLPsand genetic patterns of PGM1 (phosphoglucomutase),EsD (esterase D),GLO1 (glyoxalase)and ACP(acid phosphatase ) between the fillal generation and parental generation were detected in 15 families(among them 11 cases were aborted fetuses). The probability of paternity (w)was caculated accor-ding to Essen - Moller's formula, each w vlua was over 99. 73 %, reached the standard of incladingpaternity. An effective,rapid, and non-toxic RFLPs technique was established, which is easy to man-age in common lab oratories.
3.Akinesia deformation sequence in a fetus suspected by prenatal ultrasound and confirmed after mid-term termination
Xinyao LUO ; Qiuyang GU ; Xinxiu LIU ; Jianhua LI ; Liyan HUANG ; Xiaohua HUANG ; Shengnan WU ; Jingping YANG ; Meihua TAN
Chinese Journal of Perinatal Medicine 2022;25(3):218-221
We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.
4.Fluid shear promotes apoptosis of glomerular endothelial cells by activation of Piezo 1
Menglin LUO ; Feng ZHENG ; Xinyao JI ; Caihong QI ; Yuheng XIAO ; Changchun NIU
Basic & Clinical Medicine 2024;44(9):1236-1242
Objective To investigate the effect of fluid shear(FS)on apoptosis of glomerular epithelial cells(GECs)and the role of Piezo 1 protein in it.Methods GECs(glomerular epithelial cells)of SD rat were cul-tured.Fluid shear stimulation was simulated by a Flexcell-T5000 tensiometer.Apoptosis level was detected by flow cytometry.The expression of Piezo 1 proteins in GECs was detected by immunofluorescence staining.The activating of Piezo 1 channels by fluid shear was observed using Ca2+indicator(Cal-590 AM).The effect of Piezo 1 on apop-tosis in GECs was analyzed after modulating the function or expression of Piezo 1 protein using the chemical activa-tor Yoda1,the inhibitor GsMtx 4 was regulated by lentivirus Lv-shPiezo 1.Results Compared with the blank controlgroup,apoptosis increased in the fluid shear group(P<0.05).The rate of apoptosis increased with the enhancing of fluid shear strength;Piezo 1 was commonly expressed in GECs.Fluid shear activated Piezo 1 chan-nel and enhanced expression of Piezo 1.The agonist Yoda1 promoted the apoptosis of GECs GsMtx 4 inhibited the apoptosis induced by fluid shear.Lv-shPiezo 1 knocked down the expression of Piezo 1 in GECs and the apoptosis rate of GECs in the knockdown group was reduced as compared to that in the control group and Lv-Ctrl group(P<0.05).Conclusions Fluid shear may promote apoptosis of GECs by activation of Piezo 1 and by enhancing expression of Piezo 1.
5.Gut microbial balance and liver transplantation: alteration, management, and prediction.
Xinyao TIAN ; Zhe YANG ; Fangzhou LUO ; Shusen ZHENG
Frontiers of Medicine 2018;12(2):123-129
Liver transplantation is a conventional treatment for terminal stage liver diseases. However, several complications still hinder the survival rate. Intestinal barrier destruction is widely observed among patients receiving liver transplant and suffering from ischemia-reperfusion or rejection injuries because of the relationship between the intestine and the liver, both in anatomy and function. Importantly, the resulting alteration of gut microbiota aggravates graft dysfunctions during the process. This article reviews the research progress for gut microbial alterations and liver transplantation. Especially, this work also evaluates research on the management of gut microbial alteration and the prediction of possible injuries utilizing microbial alteration during liver transplantation. In addition, we propose possible directions for research on gut microbial alteration during liver transplantation and offer a hypothesis on the utilization of microbial alteration in liver transplantation. The aim is not only to predict perioperative injuries but also to function as a method of treatment or even inhibit the rejection of liver transplantation.
Animals
;
Gastrointestinal Microbiome
;
Graft Rejection
;
prevention & control
;
Humans
;
Intestinal Mucosa
;
physiopathology
;
ultrastructure
;
Liver Transplantation
;
Rats
;
Reperfusion Injury
;
prevention & control
6.Content Determination and Cluster Analysis of 7 Kinds of Triterpenes in Poria cocos from Different Habitats
Ming WAN ; Chao HUANG ; Yuying YANG ; Xinyao LUO ; Xiaochuan YE ; Ying DING ; Qiong DONG ; Shuhe CHEN
China Pharmacy 2020;31(17):2101-2106
OBJECTIVE:To establish a method for th e content determination of 7 kinds of triterpenoids in Poria cocos ,and to compare the differences of the above components in P. cocos from different habitats ,so as to provide reference for the quality control of P. cocos . METHODS :Using 36 batches of P. cocos from different habitats as samples ,HPLC method was used for content determination of dehydrotomorphic acid , polyporhinic acid C , 3-epidehydrotomorphic acid , 3-O-acetyl-16 α-hydroxy-hydrogenolysaccharic acid ,dehydrotomorphic acid ,pachymic acid and dehydrotrametenolic acid. The column was performed on Thermo Acclaim 120 C18 with mobile phase consisted of acetonitrile-phosphoric acid water (gradient elution )at the flow rate of 1 mL/min. The detection wavelength was set at 210 nm. The column temperature was 30 ℃,and the injection volume was 20 μL. SPSS 21.0 statistical software was used for cluster analysis of 36 batches of P. cocos from different habitats. RESULTS : The linearity of 7 triterpenoids was good in the range of their mass concentration (all r≥0.999 0);average recoveries were 96.74%-104.04%(RSD=0.54%-1.55%,n=6). RSDs of precision ,and reproducibility stability (24 h)tests were all lower than 3.0%(n=6). RSD of durability test was lower than 5.0%(n=2). There were some differences in the single content of 7 indicator components among samples from different habitats ,but the total content difference was not obvious (the total content of most samples was in the range of 1.3-1.9 mg/g). After cluster analysis ,36 batches of sample were clustered into 5 categories,i.e. S 27 was clustered into class Ⅰ;S30 and S 34 were clustered into class Ⅱ;S2,S8 and S 9 were clustered into class Ⅲ;S10,S11,S12 and S 14 were clustered into class Ⅳ;and the remaining 26 batches of samples were clustered into class Ⅴ. CONCLUSIONS :The method is simple ,and has good precision ,repeatability and durability. It can be used for the simultaneous determination of above 7 components in P. cocos . There has no significant difference in the quality of P. cocos from different habitats. The content of P. cocos in most producing areas is uniform in content and stable in quality ,only a few of them are different. Δ 基金项目 :国家重点研发计划中医药现代化研究重点专项
7.Comparison of the Quality of Sheep Bile from Different Regions Based on UHPLC-ELSD Fingerprint and Multi-component Content Determination Combined with Antioxidant Activity
Xuxiang ZHOU ; Qianqian ZHU ; Dandan ZHANG ; Xinyao LUO ; Dan LIU ; Min ZHANG ; Xiaochuan YE
Chinese Journal of Modern Applied Pharmacy 2024;41(8):1066-1074
OBJECTIVE
To establish UHPLC-ELSD fingerprint and multi-component content determination methods, compare the differences in sheep bile from different regions, and conduct antioxidant activity research to provide a basis for the in-depth development and utilization of sheep bile.
METHODS
Used UHPLC-ELSD method to establish 21 batches of bile fingerprints of sheep from different origins and conduct similarity analysis. Measured the content of 6 components, DPPH and ABTS free radical scavenging ability, iron ion reduction ability, and conducted entropy weighted TOPSIS and grey correlation analysis.
RESULTS
A total of 11 common peaks were identified in the fingerprint spectra of 21 batches of sheep bile. Through comparison with the control sample, 6 components were identified, including taurocholic acid(TCA), glycocholic acid(GCA), taurochenodeoxycholic acid(TCDCA), tauroursodeoxycholic acid(TDCA), glycodeoxycholic acid(GDCA), and cholic acid(CA). Except for 4 batches of samples, the similarity of the fingerprint spectra was greater than 0.90. The total content range of 6 components in the freeze-dried powder of 21 batches of sheep bile was 55.34% to 86.08%. The highest content of taurocholic acid ranged from 34.74% to 60.86%, indicating significant differences in the content of the six components in samples from different regions. Sheep bile from different regions had antioxidant activity, and there were also certain differences. The results of entropy weighted TOPSIS analysis using six component contents as variables showed that the top ten scoring groups were S2, S18, S16, S9, S8, S21, S1, S10, S20, and S15, indicating good quality and slightly better bile quality from sheep in the northern region. The grey correlation analysis results between the content of 6 components and 3 antioxidant indicators showed that all 6 components were correlated with each antioxidant indicator, and TCA, TDCA, and TCDCA had the highest correlation, which might be important components for sheep bile to exert antioxidant effects.
CONCLUSION
The use of entropy weighted TOPSIS and grey correlation analysis methods can effectively analyze the quality differences and antioxidant active components of sheep bile from different regions, providing scientific basis for its quality evaluation.
8.Comparison of Total Protein Content Difference of Poria cocos from Different Producing Areas
Xinyao LUO ; Jun LIU ; Huijun LI ; Tianhe WANG ; Yuying YANG ; Heyuan XIA ; Xiaochuan YE
China Pharmacy 2020;31(6):692-695
OBJECTIVE:Compare the difference of total protein content of Poria cocos from different producing areas. METHODs:Using bovine serum albumin (BSA) as control ,0.4 mol/L sodium hydroxide solution as exctraction solution , Coomassie brilliant blue G- 250 as chromogenic reagent ,visible spectrophotometry at 595 nm was used to determine the contents of total protein of P. cocos ;cluster analysis was used to classify 34 batches(S1-S34)of P. cocos from different producing areas. RESULTS:The linear range of BSA was 1.45-17.40 μ g/mL (r=0.999 6). RSDs of precision ,stability (20 min) and reproducibility tests were all lower than 3%;recoveries were 100.14%-104.26%(RSD=1.43%,n=9). The contents of total protein in 34 batches of P. cocos from different producing areas were 0.388 4%-1.129 7%. The results of cluster analysis showed that among 34 batches of P. cocos ,the total protein content of P. cocos produced in Yingshan county of Hubei province (S2,S3) was higher than 1%,clustered into one category ;the total protein contents of P. cocos produced in Hubei ,Yunnan,Anhui and Hunan(S1,S5-S10,S12,S13,S16,S17,S19-S21,S23-S25,S28,S30,S31)were 0.653 5%-0.946 1%,clustered into one categony,and the remaining batch content were 0.388 4%-0.601 2%,clustered into one category. CONCLUSIONS :Established method is suitable for the content determination of total protein content of P. cocos . The protein content of P. cocos from Yingshan county of Hubei province is the highest ,followed by Yunnan and Anhui in 34 batches of P. cocos from different producing areas.
9.Study on “Qi-invigorating”Effect and Its Mechanism of Total Saponins of Astragalus membranaceus on Rats with Qi-deficiency
Dandan ZHANG ; Tianhe WANG ; Yi YU ; Minghua HU ; Huijun LI ; Heyuan XIA ; Xinyao LUO ; Yuying YANG ; Xiaochuan YE
China Pharmacy 2020;31(24):3020-3025
OBJECTIVE:To study “Qi-invigorating”effect and its possible mechanism of total saponins of Astragalus membranaceus on rats with Qi-deficiency ,and to provide reference for elucidating the material basis of “Qi-invigorating”effect of A. membranaceus . METHODS :Forty male Wistar rats were randomly divided into normal group ,model group ,positive control group [Buzhong yiqi pills ,4.5 g/(kg·d)],A. membranaceus total saponins high-dose and low-dose groups [ 252,28 g/(kg·d),by the amount of total saponins] according to body weight ,with 8 rats in each group. Except for normal group ,the model of Qi-deficiency was made in other groups by the method of “diet disorder+fatigue ”. At the same time ,administration groups were given relevant medicine intragastrically ,and normal group and model group were given constant volume of water,once a day ,for consecutive 21 days. After last administration ,the general situation of rats was observed ;the body weight ,spleen index and thymus index of rats were detected ;weight-bearing swimming time was recorded ;the levels of spleen T lymphocyte subsets CD 3 and CD 4,the levels of ATP and ADP in liver tissue ,serum levels of ALB ,RBC and HBG in blood as well as the serum levels of SOD,MDA,lactate,LDH,CK,IL-2,IL-12 and TNF-α were all detected. RESULTS:Compared with normal group ,body weight,thymus index ,spleen index ,weight-bearing swimming time ,the level of spleen T lymphocyte subsets CD 3,ATP,ADP, ALB,IL-2 and IL- 12 were decreased or shortened significantly in model group (P<0.05 or P<0.01). The levels of MDA , lactate,CK and TNF-α were increased significantly (P< 0.05). Compared with model group ,body weight ,spleen index,weight-bearing swimming time ,the level of spleen T lymphocyte subsets CD 3 and the levels of ATP ,ADP,ALB, RBC and IL- 2 were increased significantly or prolonged(P<0.05);while the levels of MDA ,lactate,CK and TNF-α were decreased significantly in A. membranaceus total saponins high-dose group(P<0.05 or P<0.01).Weight-bearing swimming time ,the levels of ATP ,ADP and IL- 2 in A. membranaceus total saponins low-dose group were increased significantly or prolonged (P<0.05 or P<0.01),while the levels of MDA ,lactate,CK and TNF-α were decreased significantly (P<0.05 or P<0.01). Compared with positive control group ,spleen index ,spleen T lymphocyte subsets CD 3,weight-bearing swimming time and ATP level of A. membranaceus total saponins high-dose group were increased significantly or prolonged (P<0.05 or P<0.01),while MDA levels of A. membranaceus total saponins high-dose and low-dose groups were decreased significantly (P<0.05 or P<0.01). CONCLUSIONS :A. membranaceus total saponins can reduce the body ’s accumulation of blood lactic acid ,the activity of CK ,the level of lipid peroxide and regulate immunity to tonify Qi ,delay fatigue and improve exercise ability.
10.Study on Repair ,Anti-inflammation and Analgesia Effects of Compound Crocodile Oil Burn Ointment on Super- ficial Second-degree Burned Skin
Xiang PAN ; Sijie HAN ; Kezhuo CHEN ; Zhenglei LI ; Dandan ZHANG ; Xinyao LUO ; Huijun LI ; Heyuan XIA ; Tianhe WANG ; Xiaochuan YE
China Pharmacy 2021;32(20):2467-2472
OBJECTIVE:To study the repa ir,anti-inflammatory and analgesic effects of Compound crocodile oil burn ointment on superficial second-degree burned skin. METHODS :The heated weight was attached to the right depilated skin of guinea pigs for 4 s to induce the model of superficial second-degree burn. After modeling ,guinea pigs were randomly divided into model group , Jingwanhong ointment group (positive control ),formula Ⅰ,Ⅱ and Ⅲ groups of Compound crocodile oil burn ointment (volume fraction 1.5%,3%,4.5%,hereinafter),with 8 guinea pigs in each group. Except for model group ,other groups were smeared with 0.7 g/guinea pigs twice a day for 14 consecutive days. The wound healing was recorded every day ,the healing rate of wound was calculated. HE staining was used to observe the histopathological changes of the wound. The serum levels of EGF ,VEGF, SOD,MDA,TNF-α and IL-1 were detected by ELISA. Eighty Kunming mice were divided into 2 groups,and then sub-grouped into model group ,Jingwanhong ointment group (positive control ),formula Ⅰ and Ⅲ groups of Compound crocodile oil burn ointment,with 10 mice in each group. Then xylene auricle swelling method and acetic acid writhing method were used to investigate the anti-inflammatory and analgesic effects of Compound crocodile oil burn ointment. RESULTS :In the burn repair experiment,after intervention of Compound crocodile oil burn ointment ,the wound area of guinea pigs gradually decreased ,and on the 14th day ,the wound had healed greatly ,and the wound healing rate increased significantly (P<0.01);serum levels of EGF and SOD were increased significantly (P<0.01),while the levels of VEGF ,MDA,TNF-α and IL-1 were decreased significantly(P<0.05 or P<0.01). The thick new epidermal layer was found in wound tissue ,and the connective tissue and neovascularization in the dermis increased significantly. In the anti-inflammatory and analgesic experiment ,after intervention of Compound crocodile oil burn ointment ,the degree of ear swelling and the times of writhing decreased significantly (P<0.05 or P<0.01). CONCLUSIONS :Compound crocodile oil burn ointment shows good skin repair ,anti-inflammatory and analgesic efficacy;the mechanism may be associated with increasing the serum levels of EGF and SOD and reducing the levels of VEGF , MDA,TNF-α,IL-1.