1.Current Status of Stratified Diagnosis and Treatment of Sjögren's Syndrome and Reflections on It
Wenjing LIU ; Xinyao ZHOU ; Quan JIANG
Journal of Traditional Chinese Medicine 2025;66(3):244-250
Stratified diagnosis and treatment is a crucial approach in precision medicine, aiming to optimize medical care by grouping patients based on clinical manifestations, biomarkers, and pathological characteristics. Based on clinical stages, symptoms, age, gene expression, and pathology, research on Sjögren's syndrome (SS) has proposed various stratification methods, incorporating both traditional Chinese medicine (TCM) and Western medicine perspectives. These methods provide essential support for early diagnosis, risk assessment, and personalized treatment. Key strategies include moving SS intervention time forward, to leverage TCM's preventive principles, integrating TCM and Western tools to enhance precision, innovating clinical trial designs, developing multifactorial risk prediction models and digital imaging technologies, and constructing combined prognostic models for personalized follow-up and big data-driven treatment. These insights offer a comprehensive framework for advancing SS precision medicine.
2.Development of DUS Test Guidelines for New Pinellia ternata
Xinyao LI ; Mingxing WANG ; Bingbing LIAO ; Changjie CHEN ; Xiufu WAN ; Lanping GUO ; Yuhuan MIAO ; Dahui LIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(10):225-233
Pinellia ternata, belonging to the Pinellia genus within the Araceae family, is a medicinal plant due to its tubers. There are severe issues with unclear germplasm and mixed varieties in its cultivation, necessitating urgent new variety protection efforts. The distinctness, uniformity, and stability (DUS) testing of the plant variety is the basis for protecting new plant varieties, and the DUS test guidelines are the technical basis for DUS testing. To develop the DUS test guidelines for P. ternata, agronomic traits of 229 germplasm of P. ternata were observed and measured during its two growth stages over the years, and each character was graded and described. A total of 38 traits were selected as the test traits of the DUS test guideline for P. ternata. There were three plant traits, 19 leaf traits, six flower traits, two fruit traits, two tuber traits, five bulbil traits, and one ploidy trait. These traits could be divided into 22 quality characters, 12 quantitative characters, and four pseudo-quantitative characters, as well as seven groups, including plants, leaves, flowers, fruit, tubers, bulbils, and ploidy. By searching for standard traits, 10 standard varieties were ultimately determined. Preparing these guidelines will have great significance for reviewing and protecting P. ternata varieties, safeguarding breeders' rights, and promoting the development of the P. ternata industry.
3.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.
4.Interpretation of advances in immune therapy for non-small cell lung cancer at the 2025 European Lung Cancer Congress
Wen LIU ; Jiayu LU ; Xuxu ZHANG ; Xinyao XU ; Jipeng ZHANG ; Wei LI ; Guizhen LI ; Bo BAO ; Qiang LU
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(08):1063-1071
The 2025 European Lung Cancer Congress (ELCC) convened in Paris, France, centering on the optimization and innovation of immunotherapy for non-small cell lung cancer (NSCLC). Key topics at the congress included the application strategies for perioperative immunotherapy, breakthroughs in combination therapy models for advanced NSCLC, and the emerging roles of biomarkers in predicting diverse treatment outcomes. This paper integrates data from several key pivotal studies to systematically analyze the clinical value of neoadjuvant therapy within the perioperative setting, the potential of targeted combination regimens, and the challenges of managing drug resistance, thus offering new directions for clinical practice.
5.Stroke-p2pHD: Cross-modality generation model of cerebral infarction from CT to DWI images.
Qing WANG ; Xinyao ZHAO ; Xinyue LIU ; Zhimeng ZOU ; Haiwang NAN ; Qiang ZHENG
Journal of Biomedical Engineering 2025;42(2):255-262
Among numerous medical imaging modalities, diffusion weighted imaging (DWI) is extremely sensitive to acute ischemic stroke lesions, especially small infarcts. However, magnetic resonance imaging is time-consuming and expensive, and it is also prone to interference from metal implants. Therefore, the aim of this study is to design a medical image synthesis method based on generative adversarial network, Stroke-p2pHD, for synthesizing DWI images from computed tomography (CT). Stroke-p2pHD consisted of a generator that effectively fused local image features and global context information (Global_to_Local) and a multi-scale discriminator (M 2Dis). Specifically, in the Global_to_Local generator, a fully convolutional Transformer (FCT) and a local attention module (LAM) were integrated to achieve the synthesis of detailed information such as textures and lesions in DWI images. In the M 2Dis discriminator, a multi-scale convolutional network was adopted to perform the discrimination function of the input images. Meanwhile, an optimization balance with the Global_to_Local generator was ensured and the consistency of features in each layer of the M 2Dis discriminator was constrained. In this study, the public Acute Ischemic Stroke Dataset (AISD) and the acute cerebral infarction dataset from Yantaishan Hospital were used to verify the performance of the Stroke-p2pHD model in synthesizing DWI based on CT. Compared with other methods, the Stroke-p2pHD model showed excellent quantitative results (mean-square error = 0.008, peak signal-to-noise ratio = 23.766, structural similarity = 0.743). At the same time, relevant experimental analyses such as computational efficiency verify that the Stroke-p2pHD model has great potential for clinical applications.
Humans
;
Tomography, X-Ray Computed/methods*
;
Diffusion Magnetic Resonance Imaging/methods*
;
Cerebral Infarction/diagnostic imaging*
;
Stroke/diagnostic imaging*
;
Neural Networks, Computer
;
Image Processing, Computer-Assisted/methods*
;
Algorithms
6.Prevalence and associated risk factors of carotid plaque and artery stenosis in China: a population-based study.
Qingjia ZENG ; Chongyang ZHANG ; Xinyao LIU ; Shengmin YANG ; Muyuan MA ; Jia TANG ; Tianlu YIN ; Shanshan ZHAO ; Wenjun TU ; Hongpu HU
Frontiers of Medicine 2025;19(1):64-78
Stroke is a critical health issue in China, and carotid artery stenosis and plaque play key roles in its prevalence. Despite the acknowledged significance of this condition, detailed information regarding the prevalence of carotid artery stenosis and plaque across the Chinese population has been scarce. This study analyzed data from the China Stroke High-risk Population Screening and Intervention Program for 2020-2021, focusing on 194 878 Chinese adults aged 40 years and above. It assessed the prevalence of carotid artery stenosis and plaque and identified their associated risk factors. Results revealed a standardized prevalence of 0.40% for carotid artery stenosis and 36.27% for carotid plaque. Notably, the highest rates of stenosis were observed in north and south China at 0.61%, while southwestern China exhibited the highest plaque prevalence at 43.17%. Key risk factors included older age, male gender, hypertension, diabetes, stroke, smoking, and atrial fibrillation. This study highlights significant geographical and demographic disparities in the prevalence of these conditions, underlining the urgent need for targeted interventions and policy reforms. These measures are essential for reducing the incidence of stroke and improving patient outcomes, addressing this significant health challenge in China.
Humans
;
China/epidemiology*
;
Male
;
Female
;
Prevalence
;
Middle Aged
;
Carotid Stenosis/epidemiology*
;
Risk Factors
;
Aged
;
Adult
;
Plaque, Atherosclerotic/epidemiology*
;
Stroke/epidemiology*
;
Aged, 80 and over
7.Comparison of the Quality of Sheep Bile from Different Regions Based on UHPLC-ELSD Fingerprint and Multi-component Content Determination Combined with Antioxidant Activity
Xuxiang ZHOU ; Qianqian ZHU ; Dandan ZHANG ; Xinyao LUO ; Dan LIU ; Min ZHANG ; Xiaochuan YE
Chinese Journal of Modern Applied Pharmacy 2024;41(8):1066-1074
OBJECTIVE
To establish UHPLC-ELSD fingerprint and multi-component content determination methods, compare the differences in sheep bile from different regions, and conduct antioxidant activity research to provide a basis for the in-depth development and utilization of sheep bile.
METHODS
Used UHPLC-ELSD method to establish 21 batches of bile fingerprints of sheep from different origins and conduct similarity analysis. Measured the content of 6 components, DPPH and ABTS free radical scavenging ability, iron ion reduction ability, and conducted entropy weighted TOPSIS and grey correlation analysis.
RESULTS
A total of 11 common peaks were identified in the fingerprint spectra of 21 batches of sheep bile. Through comparison with the control sample, 6 components were identified, including taurocholic acid(TCA), glycocholic acid(GCA), taurochenodeoxycholic acid(TCDCA), tauroursodeoxycholic acid(TDCA), glycodeoxycholic acid(GDCA), and cholic acid(CA). Except for 4 batches of samples, the similarity of the fingerprint spectra was greater than 0.90. The total content range of 6 components in the freeze-dried powder of 21 batches of sheep bile was 55.34% to 86.08%. The highest content of taurocholic acid ranged from 34.74% to 60.86%, indicating significant differences in the content of the six components in samples from different regions. Sheep bile from different regions had antioxidant activity, and there were also certain differences. The results of entropy weighted TOPSIS analysis using six component contents as variables showed that the top ten scoring groups were S2, S18, S16, S9, S8, S21, S1, S10, S20, and S15, indicating good quality and slightly better bile quality from sheep in the northern region. The grey correlation analysis results between the content of 6 components and 3 antioxidant indicators showed that all 6 components were correlated with each antioxidant indicator, and TCA, TDCA, and TCDCA had the highest correlation, which might be important components for sheep bile to exert antioxidant effects.
CONCLUSION
The use of entropy weighted TOPSIS and grey correlation analysis methods can effectively analyze the quality differences and antioxidant active components of sheep bile from different regions, providing scientific basis for its quality evaluation.
8.Methodological Evaluation of Advantages of Traditional Chinese Medicine Treatment of Sjögren's Syndrome
Wenjing LIU ; Shiya WU ; Ruihua LIU ; Xinyao ZHOU ; Juan JIAO ; Ying LIU ; Zeguang LI ; Zhenbin LI ; Huadong ZHANG ; Xiaopo TANG ; Quan JIANG
Chinese Journal of Experimental Traditional Medical Formulae 2024;30(1):192-197
Screening and evaluating the diseases responding specifically to traditional Chinese medicine (TCM) will help to highlight the advantages of TCM treatment, and the evaluation method should be standardized with consideration to the unique characteristics of the diseases. The incidence of Sjögren's Syndrome (SS) is increasing year by year, while the pathogenesis of this disease remains unclear. Modern therapies for this disease include biological agents and immunosuppressants, which generally have unsatisfactory efficacy. The TCM treatment of SS focuses on the harmony of the physical and mental health. The Rheumatology Branch of the China Association of Chinese Medicine organizes experts in TCM, Western medicine, and evidence-based medicine to form working groups. Delphi method and bibliometric method were used for analysis, and SS was selected as a disease responding specifically to TCM. Furthermore, the evaluation system was established for this disease, and the consensus regarding this disease was reached after seminar discussion. This paper summarized the whole process of the evaluation of the advantages of TCM treatment of SS. First, because TCM atomization is widely used in clinical practice and enriches TCM administration methods, this therapy is included after other non-drug therapies were taken as characteristic therapies. Second, the evaluation indicators of therapeutic effect should be determined with consideration to international acceptance and the current research status. Third, the expression method should be accurate, standardized, and objective, highlight the natural advantages of TCM, and avoid arbitrary extension. This paper provides a reference for clinicians to explore other diseases responding specifically to TCM.
9.Analysis of the Treatment Strategy of Heart Failure with Preserved Ejection Fraction Based on ZHANG Boli's Theory of “Damp-turbidity and Phlegm-rheum Type of Diseases”
Guangning QIN ; Xinyao JIN ; Yaoyuan LIU ; Kai WANG ; Feng JIANG ; Ming HUANG
Journal of Traditional Chinese Medicine 2024;65(1):35-38
Professor ZHANG Boli believed that the core pathogenesis of heart failure with preserved ejection fraction (HFpEF) is weak pulse at yang and wiry pulse at yin. By referring to the theory of “damp-turbidity and phlegm-rheum type of diseases”, he proposed that yin pathogens of damp-turbidity and phlegm-rheum may damage yang qi in each stage of HFpEF, thus aggravating the trend of weak pulse at yang and wiry pulse at yin, which played an important role in the deterioration of HFpEF. Therefore, Professor ZHANG Boli advocated that importance should be attached to the elimination of yin pathogen and the protection of yang qi during the various stages of HFpEF in order to delay the aggravation of weak pulse at yang and wiry pulse at yin; he put forward the idea of staged treatment that “yin pathogen should be dispelled and yang qi should be demonstrated”; and he formulated the treatment strategy of treating the disease as early as possible, eliminating pathogens and protecting yang, interrupting the disease trend, using warm-like medicinals, and activating blood circulation, to enrich the theoretical system of traditional Chinese medicine in the treatment of HFpEF.
10.A meta-analysis of prevalent characteristics of injury-related behaviors among adolescents based on Chinese literature
Xiaodi BAI ; Yunlan JIANG ; Ting XU ; Siyu LIN ; Heyao XU ; Shulan LIU ; Xinyao ZHOU
Shanghai Journal of Preventive Medicine 2024;36(10):969-976
ObjectiveTo conduct a meta-analysis of the prevalent characteristics of the injury-related behaviors among adolescents in China based on Chinese literature, so as to inform the prevention and control of injury-related behaviors of this population. MethodsA cross-sectional study on the prevalent characteristics of adolescent injury-related behaviors was conducted with the data collected from CNKI, VIP, Wanfang Data, CBM, PubMed, and Web of Science. The review included publications from the inception of the databases to November 2023. Meta-analysis was performed with Stata 15.1 software. ResultsA total of 40 articles were included in this study, and the meta-analysis results showed that cycling violation rate was 38% (95%CI: 32%‒43%), walking violation rate was 29% (95%CI: 22%‒36%), rate of unsafe swimming was 13% (95%CI: 11%‒14%), suicidal ideation rate was 13% (95%CI: 12%‒15%) and the prevalence of fighting was 19% (95%CI: 17%‒22%). Subgroup analysis showed that the cycling violation rate was (44%) for boys and 34% (95%CI: 28%‒40%) for girls. Adolescents in Northeast, East, and Southwest of China had the highest rate of cycling violation (44%), of which junior high school students had the highest rate of violation [42% (95%CI: 36%‒49%)]. As for the walking violation rate, male students [29% (95%CI: 21%‒37%)] was higher than that of female students [22% (95%CI: 15%‒30%)]. Adolescents in North of China had the highest rate of walking violation [54% (95%CI: 30%‒76%)], of which vocational school students accounted for 38% (95%CI:21%‒56%) of the total violation. In terms of the detection rate of unsafe swimming, male students [18% (95%CI: 14%‒24%)] was higher than that of female students [8% (95%CI: 6%‒10%)]. Adolescents in Central South China had the highest rate of unsafe swimming [15% (95%CI: 12%‒18%)], of which, vocational school students accounted for the highest [15% (95%CI: 10%‒19%)]. When it comes to the prevalence of suicidal ideation, female students [16% (95%CI: 13%‒19%)] was higher than that of male students [13% (95%CI: 11%‒15%)]. Adolescents in Southwest of China had the highest rate of suicidal ideation [17% (95%CI: 10%‒25%)], of which high school students accounted for the highest [15% (95%CI: 12%‒18%)]. Finally, the detection rate of fights was 30% (95%CI: 26%‒34%) for boys and 11% (95%CI: 10%‒14%) for girls. Adolescents from Southwest of China had the highest rate [29% (95%CI: 24%‒34%)] for fights, and junior high school students accounted for the highest [26% (95%CI: 22%‒31%)]. ConclusionThe prevalence of harmful behaviors among adolescents in China is notably high, with statistical differences across gender, region, and school stages. These behaviors pose a risk to adolescent health, underscoring the need for targeted interventions by health and educational authorities.


Result Analysis
Print
Save
E-mail