Objective:To establish the core competency index system for emergency rescue of infectious diseases among military advance nurses, so as to provide a reference for evaluating the core emergency capability of military advanced nursing staff.Methods:The index system of emergency core competence of military advanced nursing staff in the emergency of infectious diseases was preliminarily formulated. Based on the evidence-based theory, the improved Delphi correspondence method was used to issue two rounds of questionnaires to 20 authoritative experts. After sorting out and analyzing, the effective questionnaire was formed, and the weight of each index was calculated by AHP.Results:The recovery rates of the two rounds of expert questionnaire were 100%, and the expert authority coefficients were 0.792 and 0.846, respectively; the Kendall ′s W was close to 1, which was statistically significant ( P < 0.01). Finally, three first-class indicators, 12 second-class indicators and 52 third-class indicators were determined, including knowledge related to the prevention of sudden infectious diseases, professional nursing skills and medical support capacity. Conclusion:The results show that the index content of the core emergency rescue capability system of military advanced nursing staff is centralized, the weight distribution is reasonable and has high practicability, which is conducive to improve the practical technical ability and core emergency ability of the military advanced nursing staff, improve the emergency rescue level of infectious disease emergencies and the overall medical support level of military hospitals

[Objective] To screen and identify the new Y-STR loci from the Y chromosome and examine the polymorphism of these Y-STR loci. [Method] To seek and locate the position of 5 Y-STR loci, including DYS709, DYS720, DYS721, DYS722, and DYS723, and perform sequencing of these 5 Y-STR loci. Then to investigate the polymorphism in unrelated Chinese Han males. [Results] Five Y-STR loci were identified from Y chromosome sequence. By scrutinizing the physical position on Y chromosome of previously reported Y-STRs, we found that three loci were novel and two loci overlapped with two loci published only online. All loci could be male-specifically amplified with a product size ranging from 185 bp to 278 bp. After 108 males of the Chinese Han Population (Guangzhou) were examined, we found 5 DYS709, 11 DYS720 alleles, 4 DYS721 alleles, 6 DYS722 alleles, and 6 DYS723 alleles. A total of 95 haplotypes were identified, 84 of which were unique, and with a haplotype diversity of 0.997 2±0.001 2(HD±SE). [Conclusion] This set of Y-STRs can be used as Y chromosome genetic makers in related fields.

ObjectiveTo analyze the complaints of outpatient of Guang’anmen Hospital, China Academy of Chinese Medical Sciencse, discuss the countermeasures to alleviate the contradiction and promote the normalization of the relationship between doctors and patients.Methods Based on analysis of outpatient complaints from Jan. 2008 to Dec. 2012 in our hospital, statistics and classification data were obtained from the aspects of service attitude, medical errors, process and communication.ResultsOutpatient amount of our hospital form Jan. 2008 to Dec. 2012 was 10.55 million. There were 1426 outpatient complaints (service attitudes 24.2%, medical errors 11.5%, process 40.3%, and communication 24%), etc. Complaints rate was 0.135‰ and satisfaction degree of dealing with complaints was 99.3%.Conclusion Through active service, the complaints of outpatients has been reduced, and diagnostic and treatment quality and satisfactory degree have been increased of our hospital.

Objective To analyze MRI and CT features of struma ovarii (SO).Methods CT and MRI findings of 14 patients with pathologically confirmed single SO were retrospectively analyzed.The morphology,size,density/signal intensity and enhancement pattern of lesions were analyzed.Results All the tumors appeared as well-defined cystic-solid masses,11 were multilobulated and 3 were round-like.Thirteen lesions were multicystic,and 1 was unilocular.The solid components appeared as thickness septa or wall in 11 and as nodule in 3 lesions.The maximum diameter of the tumors were 3-34 cm,with an average size of (11.34±2.24)cm.MRI showed extremely low signal intensity regions in cyst portion of 7 masses on T2WI without enhancement,while obvious enhancement in solid potion.CT showed high attenuation in cyst portion of 7 masses without enhancement,CT value were 57-90 HU,whereas the solid potion obviously enhanced,and CT values were 145-270 HU.Plaque-like calcification on the walls or nodules were observed in 4 patients.Conclusion CT and MRI findings of SO have certain characteristics,which are helpful for diagnosis and differential diagnosis.

Ectopic thyroid (ETG) is a thyroid tissue located outside the normal anatomical position, often occurring in the chest. Clinical symptoms are related to its location and its impact on adjacent structures. In ETG imaging examination, single photon emission computed tomography (SPECT) nuclide imaging of thyroid perchlorate ( 99Tc mO 4-) is the most commonly used method for localization and characterization. ETG with normal function shows high radiation uptake in the corresponding area. For difficult to distinguish tumors in the base of the tongue and the thyrohyoid region, 131I or 123I imaging with more specificity for thyroid tissue uptake is needed. ETG exhibits a variety of manifestations in computed tomography (CT) and magnetic resonance imaging (MRI), mostly irregular soft tissue density masses with clear boundaries and uneven density. There are low-density cystic changes or high-density calcifications within the masses, with uneven or uniform enhancement. In ultrasound, ETG is mainly hypoechoic, with some showing cystic solid echoes and abundant blood flow signals within the gland. Asymptomatic ETG patients usually do not require treatment, while symptomatic patients often require surgical resection and have a good prognosis. Before surgery, relevant examinations should be combined to clarify the nature of the tumor as much as possible, to avoid permanent hypothyroidism caused by misdiagnosis and misresection.

Follicular lymphoma (FL) is the most common inert B-cell lymphoproliferative disease characterized by extensive lymph node involvement, splenomegaly, and bone marrow infiltration. In recent years, with the development of molecular imaging technology and precision medicine, the imaging research of FL has been moving towards a more refined direction. 18F-FDG PET/CT plays an increasingly important role in the diagnosis, staging, efficacy evaluation, and prognosis judgment of FL patients, promoting more precise personalized treatment and improving the efficacy and survival of FL patients. This article reviews the research progress of 18F-FDG PET/CT in the diagnosis and prognosis of FL based on domestic and foreign research progress, summarizing existing literature, in order to provide reference for personalized diagnosis and treatment of FL.

We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.

Professor ZHANG Boli believed that the core pathogenesis of heart failure with preserved ejection fraction （HFpEF） is weak pulse at yang and wiry pulse at yin. By referring to the theory of “damp-turbidity and phlegm-rheum type of diseases”， he proposed that yin pathogens of damp-turbidity and phlegm-rheum may damage yang qi in each stage of HFpEF， thus aggravating the trend of weak pulse at yang and wiry pulse at yin， which played an important role in the deterioration of HFpEF. Therefore， Professor ZHANG Boli advocated that importance should be attached to the elimination of yin pathogen and the protection of yang qi during the various stages of HFpEF in order to delay the aggravation of weak pulse at yang and wiry pulse at yin； he put forward the idea of staged treatment that “yin pathogen should be dispelled and yang qi should be demonstrated”； and he formulated the treatment strategy of treating the disease as early as possible， eliminating pathogens and protecting yang， interrupting the disease trend， using warm-like medicinals， and activating blood circulation， to enrich the theoretical system of traditional Chinese medicine in the treatment of HFpEF.

Objective:Analyzing the relationship between negative life events and depressive symptoms in university freshmen,and the mediating effects of neuroticism and the moderating role of exercise frequency.Meth-ods:A sampling of 8 079 university freshmen,and the Patient Health Questionnaire was used to assess depressive symptoms,the Eysenck Personality Inventory-Neuroticism subscale to assess neuroticism,the self-administered questionnaire to assess the number of negative life events that the participants had experienced and the exercise fre-quency.Model 4 in the Process plug-in was used to test the mediating effect of neuroticism,and Model 7 to test the moderating role of exercise frequency.Results:The numbers of negative life events were positively correlated with the depressive symptoms scores(r=0.16,P＜0.01),and were positively correlated with the neuroticism scores(r=0.26,P＜0.01).The neuroticism scores were positively correlated with the depressive symptoms scores(r=0.52,P＜0.01).Neuroticism score partially mediated between negative life events and depressive symptoms score,with a mediating effect of 78.4％,and exercise frequency score moderated between negative life events and neuroti-cism scores(β=-0.05,P=0.032).Conclusion:Negative life events are associated with depressive symptoms,neuroticism plays a mediating role,and exercise frequency could moderate negative life events and neuroticism.

OBJECTIVE To investigate the role and mechanism of paeonol in inhibiting the migration of bladder cancer T24 cells by regulating nuclear factor κB （NF-κB）/hypoxia-inducible factor-1α （HIF-1α）-mediated aerobic glycolysis. METHODS T24 cells were divided into control group， cisplatin group （positive control， 3.001 μg/mL）， and paeonol low-， medium- and high-dose groups （100， 200， 400 μg/mL）， respectively. After 24 h of administration intervention， the effect of paeonol on the migration ability of T24 cells was detected （expressed by the cell scratch wound healing rate）. The effect of paeonol on the mitochondrial membrane potential of T24 cells was detected （expressed by the ratio of red/green fluorescence intensity）. Cellular adenosine triphosphate （ATP） levels and lactate content in T24 cells were measured. The levels of NF-κB/HIF-1α signaling pathway， the expression of migration-related proteins， and key enzymes involved in aerobic glycolysis in the cells were all determined. RESULTS Compared with the control group， the cell scratch wound healing rates in the paeonol medium- and high-dose groups and the cisplatin group were decreased significantly （P＜0.01）； in the paeonol groups， the expression levels of NF-κB/HIF-1α signaling pathway-related proteins such as NF- κB and HIF-1α， migration-related proteins such as matrix metalloproteinase 2 （MMP2）， MMP9， and vascular endothelial growth factor， as well as key enzymes involved in aerobic glycolysis such as glucose transporter 1， hexokinase 2 and pyruvate kinase isozyme type M2， were all reduced to varying degrees in the cells， most of these reductions showed statistically significant differences （P＜0.05 or P＜0.01）； the ratio of red/green fluorescence intensity in mitochondria of cells in the medium- and high-dose paeonol groups were significantly decreased （P＜0.01）； the ATP concentration in cells of the paeonol high-dose group， and the lactate content in cells across all paeonol groups were significantly decreased （P＜0.05 or P＜0.01）. CONCLUSIONS Paeonol significantly inhibits the migration of bladder cancer T24 cells， and its mechanism of action may be related to the inhibition of the NF-κB/HIF-1α signaling pathway， and the down-regulation of key enzyme activities involved in aerobic glycolysis.