The serum lipid and lipoprotien cholesterol levels of 1974 healthy subjects from newborn to 75 years of age and 51 patients with coronary heart disease (CHD) and cerebrovascular disease(CVD) were studied in Wuhan district. The serum lipid and lipoprotein cholseterol concentration varies with age. But no differences were found between male and female cord blood. In both sexes the serum T-C, LDL-C, HDL-C, T-C/HDL-C and LDL-C/ HDL-C ratio increased with the increasing of age. The serum HDL-C level has significant difference between male and female (P

AIM: To investigate the developmental regulation of β-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P1: TTCAGTCATGAGGATCCATT AC; P2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS： Rat β-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION： The rat β-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that β-defensin-2 may play a role in the lung innate defense against infection.

AIM: To determine tissue distribution of rat ?-defensin rBD-1 gene expression.METHODS: Total RNA was isolated from 10 kinds of rat tissues. RT-PCR were performed with primers (R 1 5′→3′ ACTCTGGACCCTGACTTCACCG; R 2 5′→3′ CCCTTGCTTGTCCTTTATGTCC). The RT-PCR products around 272 bp in size were cloned into pGEM-T easy vector and the recombinant clones were analyzed by digestion with restriction endonucleases and DNA sequencing.RESULTS: Rat ?-defensin rBD-1 transcripts were found in the kidney and skin, whereas its mRNA was not detected in trachea, uterus, bladder, small intestine, spleen, skeletal muscle, bone marrow and parotid. Sequence analysis confirmed that the RT-PCR product is rBD-1 cDNA. CONCLUSION: These data suggested that ?-defensin rBD-1 may participate not only in the kidney but also in the skin natural defense against infections.

AIM: To investigate the developmental regulation of ?-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P 1: TTCAGTCATGAGGATCCATT AC; P 2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS: Rat ?-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION: The rat ?-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that ?-defensin-2 may play a role in the lung innate defense against infection.

AIM: To study the regulation of rat ?-defensin-2 gene expression by bacteria.METHODS: E.coli ML-35 p and pseudomonas aeruginosa were injected into rat trachea. Total RNA was isolated from lung tissue after 24 h inoculation. RT-PCR and Northern blot were performed to detect ?-defensin-2 ( rBD-2 ) mRNA expression.RESULTS: The expression of rBD-2 gene was inhibited in the lung tissue by E.coli infection, but not by pseudomonas aeruginosa. CONCLUSION: These results indicated that E.coli infection could down-regulate rBD-2 gene expression in the rat lung tissues.

Objective To explore the clinical characteristics and genetic mutation types of the Mediterranean anemia in Guangxi region in the early neonatal period.Methods The observation group was the children who hospitalized in the Maternal and Child Health Hospital of Guangxi Zhuang Autonomons Region during the period of January 2013 and November 2015,and diagnosed Mediterranean anemia were 85 cases.And 85 newborns that were in the hospital at the same time were selected as the control group.The matching condition between the observation group and the control group was the gestational age.We retrospectively analyzed the general situation (birth weight and gender) and the treatment procedure (the characteristic of blood routine examinations;the day-old of the onset of anemia;the endurance of jaundice;assisted ventilation;the time of oxygen therapy;the dayold of enteral feeding;the blood transfusion times) of the two groups.And the gene was detected in the observation group.Results The observation group's days of life [(13.00 ± 3.79) d] of the oral feeding were higher than that [(9.33 ± 1.95) d] of the control group's (t =2.730,P ＜ 0.05);the observation group's frequency [(3.0 ± 1.0) times] of the blood transfusion was higher than that [(1.0 ± 0.2) times] of the control group's (t =4.268,P ＜ 0.05).The observation group's days of life [(4 ± 1) d] of anaemic onset was shorter than that [(8 ± 2) d] of the control group's (t =-3.258,P ＜ 0.05).The mean corpuscular volume [(80 ± 12) fl] in the blood routine of the observation group was smaller than that [(91 ± 28) fl] of the control group (t =6.712,P ＜ 0.05).In the observation group,the mother's age of pregnancy was (29.19 ± 0.91) years,the birth weight of the newborns was (2.356 ± 0.748) kg,the service time of the ventilator was (7.11 ± 5.07) h,the time of continue positive airway pressure was (27.40 ± 15.17) h,the time of the oxygen provision was (84.98 ± 30.65) h,the time of duration of the jaundice last was (10 ± 3) d;and in the control group,the mother's age of pregnancy was (27.9i ± 0.88) years,the birth weight of the newborns was (2.507 ± 0.783) kg,the service time of the ventilator was (6.21 ± 2.55) h,the time of continue positive airway pressure was (9.64 ± 4.89) h,the time of the oxygen provision was(63.07 ± 21.87) h,the time of duration of the jaundice last was (15 ± 2) d.The parameters showed above were not statistically different between the two groups (all P ＞ 0.05).In 85 cases the detection of α-thalassemia in 60 cases,24 patients with β-thalassemia,1 cases of α-thalassemia combined with β-thalassemia.The logistic regression analysis showed that the age of the oral feeding completely (OR =0.233,95％ CI =0.081-0.673) and the times of blood transfusion (OR =6.621,95％ CI =2.777-15.784) were the independence factors of the Mediterranean anemia.Conclusion The early clinical performance of Mediterranean anemia is lack of specificity,and we must improve genetic testing and regulate blood transfusion as soon as possible to the one who has anemia and other clinical manifestations within a week immediately following birth or who is suspected of Mediterranean anemia patients by the blood routine examination.

Objective To investigate the effect of rehabilitation stroke unit on walking in stroke patients with hemiplegia. Methods 86 patients with walking impairment after stroke were randomly divided into control group (n=43), who accepted conventional treatment, and experimental group (n=43), who were incorporated into the rehabilitation stroke unit. They were assessed with Berg Balance Scale (BBS),10 m Maximum Walking Speed (MWS), Fugl-Meyer Assessment (FMA) and modified Barthel Index (MBI) before and 8 weeks after treatment.Results The scores of BBS, MWS, FMA and MBI improved after treatment in both groups (P<0.01), and improved more in the experimental group than in the control group (P<0.05). Conclusion Rehabilitation stroke unit is effective on walking ability in stroke patients with hemiplegia.

Objective To investigate the effects of rehabilitation stroke unit on patients with shoulder-hand syndrome after stroke. Methods 90 stroke patients with shoulder-hand syndrome were divided into two groups: control group (45 cases) was treated with conventional treatment and experimental group (45 cases) was incorporated into the rehabilitation stroke unit. The therapeutic course was 6 weeks.Brunnstrom stage, Fugl-Meyer assessment (FMA) and modified Barthel index (MBI) were used to assess the degree of the motor function of upper limb and hand, and activities of daily living (ADL), and the total clinical efficacy were evaluated. Results The motor function of upper limb and hand and ADL improved in both groups after treatment (P<0.05), while the experimental group was significantly superior to the control group (P<0.05). Conclusion Rehabilitation stroke unit has preferable effect on shoulder-hand syndrome after stroke.

Objective To study the clinical characteristics and imaging features of perinatal autosomal recessive polycystic kidney disease ( ARPKD) and a systematic review of the literature was performed to improve awareness of the disease. Methods A newborn with infantile ARPKD admitted to the neonatal department of our hospital was studied and her clinical data and imaging features retrospectively reviewed. CNKI, CBMdisc, MEDLINE and Embase databases were searched using autosomal recessive, perinatal and polycystic kidney as keywords. 9 case reports were retrieved from 2005 to 2015 and a total of 9 patients were analyzed. Results The gestational age of patients with infantile ARPKD was from 33 to 37 weeks. 6 of them were diagnosed using prenatal ultrasound and one patient was diagnosed using genetic sequencing. One of 10 infants had a family history, 4 patientsˊ mothers had abnormal pregnancy history (spontaneous abortion or miscarriage) and 7 (70. 0%) patients with respiratory failure needed mechanical ventilation. The ultrasound of all the patients showed enlarged and hyperechogenic kidneys. 9 patients died, and only one patient was alive after renal transplant. Conclusions The characteristics of perinatal APRKD are enlarged and polycystic kidneys, hepatic cysts and liver fibrosis. Infants with this disease have poor outcomes and high mortality rate. Respiratory failure and renal failure are the main causes of death in the neonatal period and early diagnosis and treatment are necessary.