1.Study of ?-defensin rBD-2 gene expression in the pulmonary tissues of the fetal, neonatal and adult rats
Hui ZHOU ; Ning HUANG ; Xinnian CHEN ; Qi WU ; Boyao WANG
Chinese Journal of Pathophysiology 1986;0(03):-
AIM: To investigate the developmental regulation of ?-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P 1: TTCAGTCATGAGGATCCATT AC; P 2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS: Rat ?-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION: The rat ?-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that ?-defensin-2 may play a role in the lung innate defense against infection.
2.Down-regulation of ?-defensin-2 gene expression in E.coli-infected rat lung tissue
Xinnian CHEN ; Ning HUANG ; Qi WU ; Boyao WANG
Chinese Journal of Pathophysiology 1986;0(01):-
AIM: To study the regulation of rat ?-defensin-2 gene expression by bacteria.METHODS: E.coli ML-35 p and pseudomonas aeruginosa were injected into rat trachea. Total RNA was isolated from lung tissue after 24 h inoculation. RT-PCR and Northern blot were performed to detect ?-defensin-2 ( rBD-2 ) mRNA expression.RESULTS: The expression of rBD-2 gene was inhibited in the lung tissue by E.coli infection, but not by pseudomonas aeruginosa. CONCLUSION: These results indicated that E.coli infection could down-regulate rBD-2 gene expression in the rat lung tissues.
3.Constructed a cell line to express hBD1 stablly and detected the antimicrobial activity of hBD1 to multidrug resistant bacterial strains
Nan CUI ; Xinnian CHEN ; Lianhua WEI ; Juan LI ; Fengmei ZOU
Chinese Journal of Microbiology and Immunology 2011;31(12):1138-1142
ObjectiveTo established a cell line that expresses hBD1 stably,and detected the antimicrobial activity of the hBD1 to the muhidrug resistant bacterial strains.MethodsRecombinant plasmid was introduced into COS-7 cells by lipofectamine,cells were selected in culture medium containing G418 to acquired the monoclonal cell lines,total RNA were extracted from the cultured cells,expression levels of hBD1 mRNA was identified by RT-PCR,collected the supernatant solution of the cultured cell,expression levels of protein was identified by Western blot.Put the expression products and resistant organisms mixed together,after incubation in different times in 37℃,coating the mixtures in LB flat,then obtained the ratios between colonies number of experimental groups and colonies number of control groups,put those ratios as the survival rate of the drug resistance bacterias.Results The monoclonal cell lines had obtained after screened with G418,the hBD1 gene could be detected both at transcriptional and protein levels,Under the influence of expression product hBD1,survival rate of muhidrug-resistant Acinetobacter baumannii,multidrug-resistant Escherichia coli and multidrug-resistant Klebsiella pneumoniae could reduced to 9%,22% and 50%,but survival rate of multidrug-resistant Stenotrophomonas maltophilia is not have apparente difference with the control group.ConclusionThe stably-transfected cell line of hBD1 was successfully constructed,and the expression products of hBD1 showed the antimicrobial activity toward multidrug resistant bacterial strains.
4.Study of β-defensin rBD-2 gene expression in the pulmonary tissues of the fetal, neonatal and adult rats
Hui ZHOU ; Ning HUANG ; Xinnian CHEN ; Qi WU ; Boyao WANG
Chinese Journal of Pathophysiology 2001;17(3):226-229
AIM: To investigate the developmental regulation of β-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P1: TTCAGTCATGAGGATCCATT AC; P2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS: Rat β-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION: The rat β-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that β-defensin-2 may play a role in the lung innate defense against infection.
5.Effects of Rehabilitation Stroke Unit on Shoulder-hand Syndrome Post Stroke
Xinnian DAI ; Shouqin SHAN ; Qinghua CHEN ; Ming CAI ; Tao LIANG ; Dan WANG ; Weijuan YAN
Chinese Journal of Rehabilitation Theory and Practice 2012;18(11):1013-1015
Objective To investigate the effects of rehabilitation stroke unit on patients with shoulder-hand syndrome after stroke. Methods 90 stroke patients with shoulder-hand syndrome were divided into two groups: control group (45 cases) was treated with conventional treatment and experimental group (45 cases) was incorporated into the rehabilitation stroke unit. The therapeutic course was 6 weeks.Brunnstrom stage, Fugl-Meyer assessment (FMA) and modified Barthel index (MBI) were used to assess the degree of the motor function of upper limb and hand, and activities of daily living (ADL), and the total clinical efficacy were evaluated. Results The motor function of upper limb and hand and ADL improved in both groups after treatment (P<0.05), while the experimental group was significantly superior to the control group (P<0.05). Conclusion Rehabilitation stroke unit has preferable effect on shoulder-hand syndrome after stroke.
6.Tertiary Rehabilitation in Military Sanatorium
Qinghua CHEN ; Shouqin SHAN ; Fanggao HOU ; Xinnian DAI ; Meiyan PAN ; Yiling LIU
Chinese Journal of Rehabilitation Theory and Practice 2010;16(3):300-300
Based on the resources of military sanatorium, we developed a mode of rehabilitation that combined the hospital-, sanatorium- and community-based rehabilitation as a whole.
7.Effects of Intelligent Trunk Intensive Training on Motor and Balance for Patients with Stroke
Qinghua CHEN ; Xiutang MA ; Xinnian DAI ; Tao LIANG ; Qingfang MENG ; Weijuan YAN ; Shouqin SHAN
Chinese Journal of Rehabilitation Theory and Practice 2013;19(9):863-865
Objective To observe the effect of intelligent trunk intensive training on motor and balance for patients with stroke. Methods 80 stroke patients were divided into treatment group (n=40) and control group (n=40) randomly. Both groups accepted routine rehabilitation,and the treatment group accepted intelligence trunk intensive training in addition for 6 weeks. They were assessed with Rivermead Movement Index (RMI), the Berg Balance Scale (BBS), Sheikh trunk control ability evaluation before and after treatment. Results All the scores improved after treatment in both groups (P<0.001), and improved more in the treatment group than in the control group (P<0.001).The score of trunk control positively correlated with the score of RMI and BBS respectively (r=0.576, r=0.592, P<0.05). Conclusion Intelligent trunk intensive training can further improve the motor and balance of patients with stroke.
8. Ventilator-associated pneumonia among premature infants <34 weeks′ gestational age in neonatal intensive care unit in China: a multicenter study
Shujuan LI ; Weili YAN ; Qi ZHOU ; Shuping HAN ; Jinzhen GUO ; Shiwen XIA ; Shah VIBHUTI ; Sannan WANG ; Yong JI ; Changyi YANG ; Chuanzhong YANG ; Ruobing SHAN ; Ling LIU ; Bin YI ; Jiangqin LIU ; Zhenlang LIN ; Yang WANG ; Ling HE ; Mingxia LI ; Xinnian PAN ; Yan GUO ; Ling CHEN ; Cuiqing LIU ; Qin ZHOU ; Xiaoying LI ; Hong XIONG ; Yujie QI ; Mingyan HEI ; Yun CAO ; Siyuan JIANG ; Yi ZHANG ; K. Lee SHOO
Chinese Journal of Pediatrics 2017;55(3):182-187
Objective:
To investigate the incidence and pathogen distribution of ventilator-associated pneumonia (VAP) among preterm infants admitted to level Ⅲ neonatal intensive care units (NICU) in China.
Method:
A prospective study was conducted in 25 level Ⅲ NICU, enrolling all preterm infants <34 weeks gestational age admitted to the participating NICU within the first 7 days of life from May 2015 to April 2016. Chi-square test,
9.Penetration moxibustion with different dosage for insomnia of insufficiency of heart and spleen type.
Xiyan GAO ; Dongbin WANG ; Xinnian WANG ; Peiyu WANG ; Yali FAN ; Xinwang CHEN ; Ling GAO ; Shang MA ; Yajing GUO
Chinese Acupuncture & Moxibustion 2016;36(11):1139-1143
OBJECTIVETo observe the clinical efficacy differences between acupuncture combined with 40-min penetration moxibustion and 60-min penetration moxibustion at back-points for insomnia of insufficiency of heart and spleen type.
METHODSSixty patients of insomnia with insufficiency of heart and spleen type were randomly assigned into a 40-min group and a 60-min group. The two groups were treated with acupuncture at Jueyinshu (BL 14), Xinshu (BL 15), Geshu (BL 17), Pishu (BL 20), Shendao (GV 11) and Zhiyang (GV 9). With moxibustion box, the penetration moxibustion was applied at the back until sweating and redness on the back. The moxibustion was given for 40 min in the 40-min group and 60 min in the 60-min group. The treatment was given once a day, five days per week. Each session was consisted of 5 treatments, with an interval of 2 days between session and totally 4 consecutive weeks were provided. The Pittsburgh sleep quality index (PSQI), TCM symptom scale were observed and recorded before and after treatment in the two groups. The even temperature at raising period, effective period, reducing period, as well as minimum high temperature, comfortable temperature, minimum cold temperature and medication status were compared; also the effect was compared between the two groups.
RESULTSThe total effective rate was 96.6% (28/29) in the 60-min group, which was higher than 89.3% (25/28) in the 40-min group (<0.05). Compared before treatment, the total score of PSQI and sleep quality, sleep time, sleep efficiency, sleep disorder, daytime dysfunction as well as the total TCM symptom score and its drowsiress in the morning, palpitation, amnesia, appetite were reduced after treatment in the 40-min group (all<0.05). After treatment, the total score and each score of PSQI as well as total score and each score of TCM symptom scale were reduced after treatment in the 60-min group (all<0.05). After treatment, the total score and each score of PSQI as well as total score and each score of TCM symptom scale were significantly different between the two groups (all<0.05).
CONCLUSIONSAcupuncture combined with penetration moxibustion can improve the symptomsof insomnia with insufficiency of heart and spleen type, which is more significant in the 60-min group, indicating prolonged time of penetration moxibustion can improve sleep latency.