1.Spherical measurement-based analysis of gradient nonlinearity in magnetic resonance imaging.
Xiaoli YANG ; Zhaolian WANG ; Qian WANG ; Yiting ZHANG ; Zixuan SONG ; Yuchang ZHANG ; Yafei QI ; Xiaopeng MA
Journal of Biomedical Engineering 2025;42(1):174-180
The gradient field, one of the core magnetic fields in magnetic resonance imaging (MRI) systems, is generated by gradient coils and plays a critical role in spatial encoding and the generation of echo signals. The uniformity or linearity of the gradient field directly impacts the quality and distortion level of MRI images. However, traditional point measurement methods lack accuracy in assessing the linearity of gradient fields, making it difficult to provide effective parameters for image distortion correction. This paper introduced a spherical measurement-based method that involved measuring the magnetic field distribution on a sphere, followed by detailed magnetic field calculations and linearity analysis. This study, applied to assess the nonlinearity of asymmetric head gradient coils, demonstrated more comprehensive and precise results compared to point measurement methods. This advancement not only strengthens the scientific basis for the design of gradient coils but also provides more reliable parameters and methods for the accurate correction of MRI image distortions.
Magnetic Resonance Imaging/instrumentation*
;
Humans
;
Image Processing, Computer-Assisted/methods*
;
Nonlinear Dynamics
;
Magnetic Fields
;
Algorithms
;
Phantoms, Imaging
2.Current status and progress in the prevention and control of spinal curvatures in Chinese children and adolescents
SONG Xinli, YUAN Wen, JIANG Jianuo, LIU Zhonghui, CHEN Lu, SONG Yi, MA Jun, DONG Yanhui
Chinese Journal of School Health 2024;45(7):1059-1064
Abstract
Spinal curvatures has emerged as the third major chronic condition seriously threatening the physical and mental health of Chinese children and adolescents, with significant regional differences. Its etiology is complex and diverse, and early prevention and treatment are feasible, whereas treatment in later stages entails considerable difficulty and economic burden. Currently, the prevention and control of student spinal curvatures has been elevated to a national health strategy. A series of policy documents have been successively issued, and it has greatly facilitated the institutionalization and normalization of national routine screening for student spinal curvatures. However, it is still inadequate considering current prevention and control system for spinal curvatures in children and adolescents. There is an urgent need to establish a closed loop model based on China s institutional advantages, comprising Initial Screening-Diagnosis-Treatment-Preventive Control-Followup Assessment, to strengthen the safeguarding of spinal health in children and adolescents.
3.Research on the risk factors and cumulative risk of myopia in children and adolescents
Yang QIN ; Wen YUAN ; Tian YANG ; Xiuhong ZHANG ; Li CHEN ; Yi ZHANG ; Jianuo JIANG ; Qi MA ; Ziqi DONG ; Xinli SONG ; Jieyu LIU ; Ruolin WANG ; Yi SONG ; Jun MA ; Yanhui DONG
Chinese Journal of Epidemiology 2024;45(8):1126-1133
Objective:To investigate the risk factors and cumulative risk of myopia in children and adolescents, providing a basis for identifying cumulative risk factors in preventing and controlling myopia.Methods:Baseline data from the mental and physical health cohort of children and adolescents established in Inner Mongolia Autonomous Region were used. A stratified random cluster sampling method was adopted to select 138 974 students from fourth to twelfth grade as participants. Distance visual exams, refractive assessments, and questionnaires were conducted on the included students. Logistic regression analysis was used to evaluate each risk factor's impact on myopia's prevalence. The number of risk factors was summed to form a cumulative risk score, and logistic regression analysis was conducted to examine the association between the cumulative risk score and the prevalence of myopia. Additionally, the association between the cumulative risk score of myopic students and their degree of refractivity was analyzed using a generalized estimating equation.Results:The study found a high prevalence of myopia among children and adolescents at baseline (70.2%). Girls exhibited a higher prevalence (74.8%) than boys (65.6%), urban areas (74.3%) surpassed suburban ones (68.6%), and the incidence was greater in high schools (80.3%) compared to middle schools (75.3%), which, in turn, was higher than in elementary schools (57.7%) (all P<0.05). Analysis of risk factors revealed that children and adolescents experiencing improper reading and writing distances ( OR=1.10, 95% CI: 1.07-1.13), excessive homework ( OR=1.09, 95% CI: 1.06-1.12), insufficient sleep ( OR=1.10, 95% CI: 1.07-1.13), having myopic father ( OR=1.98, 95% CI: 1.91-2.05), having myopic mother ( OR=2.04, 95% CI: 1.97-2.10), or using classroom chairs not matched to their height faced ( OR=1.04, 95% CI: 1.01-1.07) increased myopia risks. Additionally, the prevalence and significant odds ratio of myopia increased with the increase in cumulative risk score, with every additional unit of cumulative risk score increasing the right eye's refractive error by -0.10 D. Conclusion:The presence of multiple factors and their comprehensive score increases the prevalence of myopia in children and adolescents.
4.Current status of regional school health work in Tianjin during 2019-2023
Chinese Journal of School Health 2024;45(5):620-625
Objective:
To explore the current status and progress of regional school health work to provide policy reference for school health improvement.
Methods:
Survey data on school health work in Tianjin from 2019, 2021 and 2023 was used. School health staff allocation and expenditure of the health administrative department, CDC and education department, as well as the annual implementation of health education, prevention and control of common diseases and infectious diseases, sports activities and food nutrition in primary and secondary schools were analyzed. Statistical analysis was conducted using KruskalWallis test, Chisquare test, and Fishers exact test.
Results:
The number of school health staff in the health commissions and education departments from 2019, 2021 and 2023 was relatively stable. Parttime staffs were often employed by health commissions while fulltime staffs were mainly employed by education departments. The number of school health staff at CDCs increased gradually (H=12.65, P<0.01). School health expenditure of administrative departments and schools in 2021 and 2023 increased significantly compared with that in 2019 (H=22.28, 23.75, P<0.05). More than 95% of schools set up clinics or health care rooms, and about 97% of schools had school health technicians or health teachers. More than 90% of schools had health education courses over 4 hours per semester. The rate of mental health education increased by year (86.87%, 89.91%, 96.30%, Z=2.40,P<0.05). Lack of courses regarded safety emergency and risk avoidance, growth and development, and adolescent health education. The provision rate of psychological counseling services (89.00%, 97.25%, 100.00%) and psychological problem prevention and control (56.12%, 71.56%, 81.48%) also increased by year (Z=3.83, 3.96, P<0.01). The implementation rates of prevention and control of poor vision, dental caries, overweight and obesity were all higher than 80%, and the prevention and control rate of abnormal spinal curvature showed an increasing trend (38.78%, 77.06%, 72.22%, Z=4.87, P<0.01). More than 90% of schools met the standard for physical education class hours, and the proportion of schools conducting at least 30 minutes of recess physical activities every day increased year by year (65.00%, 80.73%, 85.98%, Z=3.59, P<0.01). All schools did not have shops.
Conclusions
School health work in Tianjin is effective and constantly developing. It is necessary to continue to increase the investment of human resources and expenditure in school health, explore the approaches of cooccurrence and prevention of common diseases, and improve the school sports and nutrition environment.
5.Application value of antegrade splenic superior region dissection first in laparoscopic total gastrectomy of obesity gastric cancer
Danhua XU ; Jiayi GU ; Xinli MA ; Chunchao ZHU ; Ming WANG ; Enhao ZHAO ; Zizhen ZHANG ; Jiangfeng QIU ; Hui CAO
Chinese Journal of Digestive Surgery 2024;23(4):609-612
Objective:To investigate the application value of antegrade splenic superior region dissection first in laparoscopic total gastrectomy of obesity gastric cancer.Methods:The retrospective and descriptive study was conducted. The clinicopathological data of 21 obesity patients with gastric cancer who underwent laparoscopic total gastrectomy in Renji Hospital of Shanghai Jiaotong University School of Medicine from July 2018 to October 2023 were collected. There were 16 males and 5 females, aged (58±13)years. All 21 patients underwent laparoscopic total gastrec-tomy with antegrade splenic superior region dissection first. Observation indicators: operation time, volume of intraoperative blood loss, laparotomy conversion, intraoperative splenic hemorrhage or gastric hemorrhage, lymph node dissection, time to postoperative first flatus, time to postoperative initial liquid food intake, duration of postoperative hospital stay, postoperative complication. Measure-ment data with normal distribution were represented as Mean± SD, and count data were expressed as absolute numbers. Results:All 21 patients underwent laparoscopic total gastrectomy success-fully, with the operation time of (283±47)minutes, time for splenogastric ligament and vascular manage-ment of (34±12)minutes, volume of intraoperative blood loss of (143±86)mL, and no laparotomy conversion. There was no intraoperative splenic hemorrhage or gastric haemorrhage. The total number of lymph node dissected in 21 patients was 375, with the number of lymph node dissected as (21±9)per case. Time to postoperative first flatus, time to postoperative initial liquid food intake and duration of postoperative hospital stay in 21 patients were (3.1±0.7)days, (4.0±0.8)days and (10.1±3.0)days, respectively. There were 2 patients with postoperative complications, including 1 case of incision infection and 1 case of lung infection. The 2 patients with postoperative com-plications were recovered and discharged after conservative treatment. There was no death during the postoperative 30 days.Conclusion:The application of antegrade splenic superior region dissec-tion first in laparoscopic total gastrectomy is safe and feasible, which can reduce surgical difficulty.
6.Effect of ultrasound-guided quadratus lumborum block on intraoperative hemodynamics and opioid dosage in emergency patients with ectopic pregnancy
Dongfeng MA ; Meilin AN ; Guixiang GUO ; Lei ZHANG ; Yu LI ; Fuyu TIAN ; Xinli HUANG
Chinese Journal of Integrated Traditional and Western Medicine in Intensive and Critical Care 2024;31(2):234-238
Objective To study the effects of ultrasound-guided quadratus lumborum block(QLB)on intraoperative hemodynamics and opioid dosage in emergency patients with ectopic pregnancy.Methods A total of 70 patients with ectopic pregnancy undergoing laparoscopic surgery in Langfang People's Hospital from January 2021 to February 2024 were selected as subjects.According to the different anesthesia methods,the patients were divided into the control group and the study group,with 35 cases in each group.The control group was given general anesthesia,while the study group additionally added ultrasound-guided QLB.The intraoperative sedation effect,hemodynamics,postoperative pain,incidence of adverse reactions and opioid use at different times(admission,entry,intubation,skin incision,extubation,and discharge)were observed in the two groups.Results There were no statistically significant differences in the onset time of sedation,the rate of salvage sedation,the incidence of intraoperative body movements,the modified observer's assessment of alert/sedation(MOAA/S)at each time,and the hemodynamics at the time of admission,entry and intubation between the two groups.The mean arterial pressure(MAP),systolic blood pressure(SBP)and heart rate(HR)in the study group were significantly lower than those in the control group during skin incision,extubation and discharge[skin incision:MAP(mmHg,1 mmHg≈0.133 kPa)was 85.24±4.59 vs.96.95±4.68,SBP(mmHg)was 92.24±4.85 vs.99.49±5.13,HR(times/min)was 85.33±2.96 vs.94.51±2.92;extubation:MAP(mmHg)was 94.84±5.02 vs.102.05±5.13,SBP(mmHg)was 96.48±4.72 vs.105.03±5.07,HR(times/min)was 95.51±4.95 vs.102.49±5.87;discharge:MAP(mmHg)was 86.14±4.99 vs.93.71±5.25,SBP(mmHg)was 96.48±4.69 vs.104.37±5.02,HR(times/min)was 84.05±4.57 vs.90.51±4.86,all P<0.05]and pulse oxygen saturation(SpO2)was higher than those in the control group(skin incision:0.988 5±0.012 2 vs.0.965 4±0.012 3,extubation:0.974 7±0.012 4 vs.0.963 2±0.012 1,discharge:0.981 1±0.012 4 vs.0.970 3±0.012 3,all P<0.05).The resting numeric rating scale(NRS)scores and active NRS scores in the study group were lower than those in the control group at 3,6,12,and 24 hours after surgery,the random time was prolonged,the resting NRS and active NRS in the two groups gradually increased,reaching a peak at 24 hours after surgery,and the resting NRS and active NRS in the study group were significantly lower than those in the control group(resting NRS:3.86±0.82 vs.4.53±1.04,active NRS:4.26±1.05 vs.4.85±1.13,all P<0.05).The incidence of adverse reactions in the study group was lower than that in the control group[11.43%(4/35)vs.34.29%(12/35),P<0.05].The dosage of Sufentanil in 24 hours and 48 hours,the number of analgesic pump in 48 hours and the number of relief analgesia cases in the study group were lower than those in the control group[the dosage of Sufentanil in 24 hours(μg):23.28±4.02 vs.36.14±4.57,the dosage of Sufentanil in 48 hours(μg):41.61±4.82 vs.59.33±6.25,the number of analgesic pump in 48 hours(times):2.94±1.22 vs.6.15±1.71,the proportion of relief analgesia:8.57%(3/35)vs.28.57%(10/35),all P<0.05].Conclusion Ultrasound-guided QLB can reduce hemodynamic fluctuations,relieve postoperative pain,reduce adverse reactions and opioid use in emergency patients with ectopic pregnancy,demonstrating a positive impact.
7.Effect of quadrate lumbomuscle block anesthesia on blood gas indexes and postoperative recovery in female uremic patients undergoing peritoneal dialysis catheterization
Meilin AN ; Dongfeng MA ; Guixiang GUO ; Lei ZHANG ; Yu LI ; Fuyu TIAN ; Xinli HUANG
Chinese Journal of Integrated Traditional and Western Medicine in Intensive and Critical Care 2024;31(4):451-454
Objective To observe the effect of quadratus lumborum block(QLB)anesthesia on intraoperative blood gas indexes and postoperative recovery in female uremic patients with peritoneal dialysis catheterization.Methods A total of 70 female uremic patients with peritoneal dialysis catheterization admitted to Langfang People's Hospital from January 2021 to December 2023 were selected as the research objects.According to the random number table method,they were divided into the control group and the study group,with 35 cases in each group.The control group was given conventional local infiltration anesthesia,whereas the study group was given QLB anesthesia.The changes of mean arterial pressure(MAP),heart rate(HR),blood gas indexes[pulse oxygen saturation(SpO2),arterial partial pressure of carbon dioxide(PaCO2)]and numeric rating scale(NRS)score,at different points pain factors[5-hydroxytryptamine(5-HT),substance P(SP),norepinephrine(NE)]before operation and 24 hours after operation,postoperative recovery(time to get out of bed for the first time,exhaust time,length of hospital stay)and adverse reactions were observed in the two groups.Results There was no significant difference in MAP,HR,blood gas index and NRS score between the two groups at the admission.The MAP,HR,PaCO2 in the study group were significantly lower than those in the control group during skin incision,rectus abdominis separation,catheterization,suture,and leaving the room,and SpO2 was significantly higher than that in the control group,and NRS score in the study group were significantly lower than those in the control group during skin incision,rectus abdominis separation,catheterization,suture(all P<0.05).There was no significant difference in the levels of 5-HT,SP and NE between the two groups before operation,but the levels of 5-HT,SP and NE at 24 hours after operation were significantly higher than those before operation,but the levels of 5-HT,SP and NE in the study group were lower than those in the control group.The first ambulation time,exhaust time and hospitalization time in the study group were significantly shorter than those in the control group(all P<0.05).The incidence of nausea and vomiting,constipation,pruritus,dizziness and other adverse reactions in the study group was significantly lower than that in the control group(all P<0.05).Conclusion QLB can reduce the fluctuation of intraoperative blood gas indexes in female uremic patients with peritoneal dialysis catheter,relieve postoperative pain,reduce the level of pain factors and reduce the occurrence of adverse reactions,and has a good effect on promoting postoperative recovery of patients.
8.Research on the present situation of detection strategies for infectious markers related to transfusion transimission in China
Wei TAN ; Shengyan YING ; Ning CHENG ; Yujun LI ; Xiaoli CHEN ; Fang WANG ; Yang ZHANG ; Xiaojie LIU ; Lin BAO ; Yong DUAN ; Chen MA ; Chunlan LIU ; Dengfeng WANG ; Zhijun ZHEN ; Li LI ; Jian ZHANG ; Ranran LU ; Peng WANG ; Mingxia LI ; Xinli JIN ; Xiaobo CAI ; Mei YU ; Jianling ZHONG ; Lili ZHU ; Jianping LI
Chinese Journal of Experimental and Clinical Virology 2023;37(4):383-388
Objective:To analyze the detection strategy and basic detection situation of markers of infectious diseases transmitted by transfusion in blood testing laboratories of blood stations in China.Methods:Based on the data of practice comparison working party of Blood Stations in Mainland of China from 2017 to 2021, the data on the testing strategies and the basic detection information of the markers for the transmission of infectious diseases through transfusion in the member laboratories of the practice comparison working party of Blood Stations in Mainland of China from 2017 to 2021 were collected, and the situation of the selection for testing markers, testing strategy and the testing method and other relevant aspects were sorted out and analyzed by charts.Results:The selection of the testing markers was consistent, but HTLV testing item was added in some member laboratories. The detection strategy of using two ELISA reagents and one nucleic acid testing (NAT) reagent simultaneously was adopted in 47 member blood stations; 3) NAT method was dominated by mini pool-NAT in member laboratories. The number of members adopting mini-pools of 8 (MP8)-NAT decreased from 17 in 2017 to 14 in 2021, while the number of members adopting mini-pools of 6 (MP6)-NAT increased from 13 in 2017 to 22 in 2021; Roche NAT system accounted for the largest proportion.Conclusions:In order to ensure blood safety and avoid missing detection, the blood stations still adopt the detection strategy of using two ELISA reagents and one nucleic acid testing (NAT) reagent simultaneously; Meanwhile, in order to increase the NAT positive rate, the proportion of mini pool-NAT mainly decreased year by year despite its dominating role, while the proportion of individual donation-NAT increased year by year; NAT method is transiting from mini-pools of 8 (MP8) to mini-pools of 6 (MP6); The proportion of imported NAT system used in NAT laboratory is relatively large.
9.Co-occurrence trend of overweight,obesity and elevated blood pressure and its association with lifestyle factors among students in Inner Mongolia Autonomous Region
Chinese Journal of School Health 2023;44(9):1313-1318
Objective:
To explore the epidemiological trend of overweight and obesity, elevated blood pressure and their comorbidities in children and adolescents from Inner Mongolia Autonomous Region during 2016-2021, and to analyze its association with lifestyle, so as to provide reference for formulating prevention and control strategies of regional common comorbidities in schools.
Methods:
A total of 8 908, 8 222, 9 448, 127 068, 100 778, and 138 540 students aged 10-18 years in Inner Mongolia were selected by stratified random cluster sampling in September each year from 2016 to 2021. Physical examination and questionnaire survey were conducted on the included students. The prevalence trends of overweight,obesity, elevated blood pressure and their co-occurrence were analyzed. Logistic regression was used to compare the prevalence of elevated blood pressure in different body mass index (BMI) groups. After excluding individuals without lifestyle information in 2021, Logistic regression analysis was used on 136 374 subjects to analyze the association between overweight,obesity, elevated blood pressure and their co-occurrence and lifestyle factors.
Results:
During 2016 to 2021, the prevalence of comorbidity of overweight, obesity with elevated blood pressure among students in Inner Mongolia Autonomous Region were 5.04%,5.14%,4.99%,7.51%,7.60% and 9.45%, respectively . The prevalence of overweight and obesity was 26.94%, 28.07%, 29.62%, 34.19%, 36.71% and 37.53%, respectively. The prevalence of elevated blood pressure were 16.05%, 11.54%, 13.12%, 14.85%, 14.12% and 18.40%, respectively. Except for 2016, the risk of elevated blood pressure in overweight and obese people was higher than that in normal BMI group in other years, and there was a positive correlation between overweight and obesity and elevated blood pressure after gender and urban and rural areas ( P < 0.05 ). In 2021, the detection rate of comorbidity of overweight and obesity with elevated blood pressure among children and adolescents in urban areas was higher than that in suburban counties, and the reporting rate of healthy lifestyle was lower than that in suburban counties ( P <0.05).Skipping breakfast ( OR =1.11,95% CI =1.07-1.16) and non daily moderate and high intensity physical activity( OR =1.27,95% CI =1.20-1.34) were positively correlated with the co-occurrence of overweight,obesity and elevated blood pressure among children and adolescents in Inner Mongolia Autonomous Region. Non daily moderate and high intensity physical activity ≥60 min was positively correlated with elevated blood pressure ( OR =1.11,95% CI =1.07-1.16), and insufficient sleep was positively correlated with overweight,obesity ( OR =1.04, 95% CI =1.01-1.06)( P <0.05).
Conclusion
The prevalence of overweight,obesity, elevated blood pressure and their co-occurrence among children and adolescents in Inner Mongolia Autonomous Region is relatively high. Overweight/obesity is an important risk factor for elevated blood pressure, and unhealthy lifestyles are risk factors for co-occurrence of overweight,obesity and elevated blood pressure. Region specific lifestyle interventions are indispensable for the prevention and control of regional common comorbidities. Urban areas may be a key focus for lifestyle interventions.
10.Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4
Tingting YANG ; Shuzhen MA ; Ling LYU ; Yuan CHEN ; Ya′nan ZHANG ; Xinli BAI
Chinese Journal of Applied Clinical Pediatrics 2023;38(6):457-460
Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.


Result Analysis
Print
Save
E-mail