1.The analysis of curative effect of the modified McBride's procedure on correcting mild-moderate hallux val-gus
Xingchao YAN ; Zhigang LIU ; Yuehai PAN ; Xiaoyan JIA ; Jianfeng LIU ; Yanan ZHANG ; Jiangbo SHAO ; Bin LIU
Chinese Journal of Primary Medicine and Pharmacy 2015;(8):1146-1148
Objective To explore the curative effect of clinical application of modified McBride's procedure on correcting mild-moderate hallux valgus.Methods We had retrospectively assessed 32 patients(52 feet)treated with the procedure of modified McBride's procedure.All patients were followed up,the follow -up period from 6 months to 6 years(3.1 years on average).There were 2 male(4 feet)patients and 30 female(48 feet)patients in this group.The average age at the time of surgery was 41.6 years old(from 21 to 59 years).Results According to the forefoot score of American Orthopedics Foot and Ankle Society(AOFAS),29 feet(55.8%)were excellent,17 feet (32.7%)were good,And the rate of excellent and good was 88.5%.The average correction of HVA and IMA was 13.68°and 3.24°respectively compared with the preoperative cases.Conclusion This procedure can not only effec-tively reduce the increased hallux valgus angle,but also narrow the angle between the 1st and 2nd metatarsal,relocate the sesamoid system,and effectively relieve patients'pain.This approach is of minor side effects to bone and joint structure,and of rapid recovery.It is a preferential choice to treat mild-to-moderate hallux valgus deformity.
2.Establishment of a multiplex real time quantitative PCR method for CMV promoter nucleic acid sequences detection
Yufa MIAO ; Sanlong WANG ; Xiaobing ZHOU ; Yan HUO ; Xingchao GENG ; Jianjun LYU ; Jufeng WANG ; Bo LI
Chinese Journal of Pharmacology and Toxicology 2014;(2):296-301
OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.
3.Clinical application of detection of procalcitonin and high sensitivity C-reactive protein in the early diagnosis of bloodstream infection
Houlong LUO ; Yan NONG ; Zhichao MIU ; Shan MO ; Donghong LIU ; Xingchao LIU
International Journal of Laboratory Medicine 2014;(21):2887-2888,2890
Objective To investigate the clinical value of detection of procalcitonin(PCT ) and high sensitivity C-reactive protein (hs-CRP) in early diagnosis of bloodstream infection(BSI) .Methods The serum levels of PCT and hs-CRP of 58 BSI patients(test group) and 58 non BSI patients(control group) were detected .The early diagnosis value of PCT and hs-CRP was evaluated by ROC curve .Results There were significant difference between the serum PCT and hs-CRP levels of test group and control group(P<0 .05) .The ROC AUC of PCT and hs-CRP were 0 .902(95% CI:0 .850-0 .955) and 0 .706(95% CI:0 .611-0 .801) ,respectively . With 2 .24 ng/mL being the diagnostic cut-off value ,the diagnostic sensitivity ,specificity ,positive predictive value ,and negative pre-dictive value of PCT were 77 .6% ,91 .4% ,90 .0% ,and 80 .3% ,respectively .With 64 .83 mg/L being the diagnostic cut-off value ,the di-agnostic sensitivity ,specificity ,positive predictive value ,and negative predictive value of hs-CRP were 74 .1% ,62 .1% ,54 .4% ,and 59 .5% , respectively .Conclusion Detection of serum PCT and hs-CRP has important clinical value in early diagnosis of BSI .
4.Short-term and long-term prognosis analysis of anatomical liver resection for the treatment of perihilar cholangiocarcinoma
Xianghao YE ; Zhipeng LIU ; Haisu DAI ; Yi GONG ; Hao LI ; Zhihua LONG ; Wei WANG ; Yuhan XIA ; Shujie PANG ; Longfei CHEN ; Xingchao LIU ; Haining FAN ; Jie BAI ; Yan JIANG ; Zhiyu CHEN
Tumor 2023;43(6):506-515
Objective:To explore the short-term and long-term prognostic outcomes of anatomical liver resection(AR)for patients with perihilar cholangio-carcinoma. Methods:This is a retrospective study.All data were obtained from 4 centers,including The First Affiliated Hospital of Army Medical University,Eastern Hepatobiliary Hospital of Naval Medical University,Sichuan Provincial People's Hospital and Affiliated Hospital of Qinghai University,of a multi-center database.A total of 305 consecutive perihilar cholangiocarcinoma patients receiving radical resection between January 2013 and June 2021 were included in this study.According to the method of liver resection,all patients were divided into the AR group(n=205)and the non-anatomical liver resection(NAR)group(n=100).The baseline characteristics,short-term prognosis and long-term prognosis of the 2 groups were compared. Results:The perioperative transfusion rate and the 30-day complication rate were significantly lower in the AR group than those in the NAR group(P<0.05).There was no statistically significant difference in the survival rates between the AR and the NAR groups(P>0.05). Conclusion:The 2 hepatic resection modalities had no obvious effect on the long-term prognosis of perihilar cholangiocarcinoma patients after radical resection,but choosing AR tends to achieve a better short-term prognosis and is worth promoting in clinical practice.
5.Introduction and Comparison Study of RxNorm ,WHODrug and SNOMED CT Medicine Terminology
Xingchao QIAO ; Chao CHEN ; Zongyou LI ; Yan ZHU
China Pharmacy 2019;30(10):1297-1301
OBJECTIVE: To provide reference for the construction of medicine terminologysets in China.METHODS: By introducing and comparing naming rules, terminology type and classfication system of RxNorm, WHODrug and SNOMED CT, the relevant suggestions on the construction of medicine terminology sets in China were put forward. RESULTS & CONCLUSIONS: Due to the different demanding objects and specific application scenarios of different terminology sets, the three medicines terminology sets had their own characteristics.RxNorm mainly served electronic health records and medical insurance, and its medicine terminology contained the trade name information of the medicine. WHODrug mainly served ADR reports, and its structured medicine information data carried by the Drug Code, and the set adopted the system classification system-ATC. In order to promote the international interoperability of medicines concepts, SNOMED CT did not contained the trade name,and the purpose of classification was to define drugs. It is suggested that the construction of China’s medicine terminology sets should be based on the design and practical experience of foreign advanced drug terminology, encourage hospitals or pharmaceutical companies to disclose and share data, and try to build a drug model compatible with chemical drugs and proprietary Chinese medicines to adapt to the special nature of Chinese medicines and the needs of international communication.