1.Effects of PPARs agonists on the MCP-1 expression induced by Ang Ⅱ in endothelial cells
Chunhui LI ; Mingyue TAN ; Xingchao ZHANG
Chinese Journal of Geriatrics 2003;0(09):-
Objective To study the effect of angiotensinⅡon the expression of monocyte chemoattractant protein-1 (MCP-1) in cultured human umbilical vein endothelial cells(hUVEC) , and the effect of peroxisome proliferator- activated receptors (PPARs)?and?on MCP-1. Methods MCP-1 protein level was detected by enzyme-linked immunosorbent assay (ELISA) method, and the mRNA expression level of MCP-1 was determined by RT-PCR. Results AngiotensinⅡdistinctly increased the expression of MCP-1 in a dose-dependent manner in cultured hUVECs, and valsartan inhibited the expression of MCP-1 remarkably. Both rosiglitazone (PPAR7 agonist) and fenofibrate (PPAR?agonist) concentration- dependently reduced the expression of MCP-1 in induced by AngⅡ10-6 mol/L. Conclusions AngiotensinⅡcan increase the expression of MCP-1 evidently in hUVECs, which is inhibited by valsartan. The activation of PPARa and PPAR?can decrease the expression of MCP-1 in hUVECs.
2.Effects of two fluorides on the fluoride content in the deciduous teeth enamel:A clinical study
Yakun PING ; Xingchao LI ; Jianping JIAO
Journal of Practical Stomatology 1995;0(04):-
Objective:To determine the fluorine content in enamel before and after besmearing fluoride varnishes or fluorinated bubbles. Methods:Thirty patients whose deciduous central incisors will be extracted were divided into group a and b randomly. For the same patient, a pair of mandibular deciduous central incisor were chosen. For group a: one tooth was removed, and the other one besmeared with fluoride varnishes and removed 24 h later. For group b: one tooth was removed, and the other one besmeared with fluorinated bubbles and removed 24 h later. The fluorine contents in the enamel of every tooth were determined by neutron activation method and analyzed statistically. Results:For group a: the fluorine content in the experimental group was (142.78?42.25) ?g/g, and that in the control group was(119.62?38.62) ?g/g. For group b: (162.36?31.36) ?g/g and (126.56?38.42) ?g/g respectively. The fluorine content in the enamel of tooth besmeared with fluoride varnishes or fluorinated bubbles was higher than that in the control group(P
3.Changes of T lymphocyte subsets in mice immunized with recombinant Bb-Em Ⅱ/3-Em14-3-3 vaccine of Echinococcus multilocularis
Mei YANG ; Wengui LI ; Xingchao LIU
Chinese Journal of Endemiology 2016;35(9):629-632
Objective In order to investigate the changes of T lymphocytes subsets in mice immunized with recombinant Bb-Em Ⅱ/3-Em14-3-3.vaccine of Echinococcus multilocularis (Em) and challenged with Em protoscoleces.Methods BALB/c mice were immunized with recombinant Bb-Em Ⅱ/3-Em14-3-3 vaccine by subcutaneous injection,intramuscular injection,nasal mucosa inoculation and oral administration,Bifidobacterium (Bb) and PBS were used as controls.After 12 weeks of immunization,all the mice were challenged with 50 protoscoleces of Em by intraperitoneal injection.Eighteen weeks later,mice were killed to measure alveolar hydatid weight and spleens were taken to separate spenocytes,in which the percentages of CD4+ and CD8+ T cell subsets were determined by flow cytometry.Results Alveolar hydatid weight was (0.77 ± 0.52),(0.87 ± 0.60),(2.17 ± 0.50),(3.06 ± 0.15) g in subcutaneous injection,intramuscular injection,nasal mucosa inoculation and oral administration groups,respectively,which was obviously lower than that in PBS control group [(3.54 ± 0.32) g,P < 0.05 or < 0.01].The level of CD49 T cell subset was (28.2 ± 2.5)%,(25.0 ± 2.7)%,(24.0 ± 1.3)%,(23.0 ± 1.8)% in subcutaneous injection,intramuscular injection,nasal mucosa inoculation and oral administration groups,respectively,which was significantly higher than that in PBS control group [(16.1 ± 2.2)%,all P < 0.01].The level of CD8+ T cell subset in the immunization groups was slightly elevated,but there was no statistical significance between groups (F =1.36,P >0.05).The level of CD4 + T cell subset in subcutaneous injection group was higher than that in intramuscular injection,nasal mucosa inoculation and oral administration groups (all P < 0.05).Conclusion CD4+ T cell subset may play an important role in the protection of mice induced by recombinant Bb-Em Ⅱ/3-Em14-3-3 vaccine and the subcutaneous injection route appears to be a better way for immunization.
4.Therapeutic effect of atorvastatin on inflammatory factor levels and vascular endothelial function in patients with coronary heart disease
Qian WANG ; Xinwen MIN ; Dongfeng LI ; Mingjian LANG ; Xingchao LI
Chinese Journal of cardiovascular Rehabilitation Medicine 2017;26(4):420-424
Objective:To explore therapeutic effect of atorvastatin on inflammatory factor levels and vascular endothelial function in patients with coronary heart disease (CHD).Methods: A total of 112 CHD patients treated in our hospital were selected.According to random number table, they were randomly and equally divided into routine treatment group and atorvastatin group, and both groups were treated for eight weeks.Serum levels of inflammatory factors and vascular endothelial function before and after treatment, angina pectoris and ECG therapeutic effect after treatment, and incidence of adverse reactions during medication were compared between two groups.Results: Compared with before treatment, after treatment, there were significant reductions in serum levels of interleukin (IL)-6, tumor necrosis factor (TNF)-α, C reactive protein (CRP), intercellular adhesion molecule (ICAM)-1 and endothelin (ET)-1, and significant rise in nitric oxide (NO) level, left ventricular ejection fraction (LVEF) and cardiac output (CO) in both groups,P<0.01 all;compared with routine treatment group after treatment, there were significant reductions in serum levels of IL-6 [(157.42±30.13) pg/ml vs.(129.83±27.31) pg/ml], TNF-α [(25.41±2.67) ng/L vs.(21.38±2.13) ng/L], CRP [(19.87±2.78) mg/L vs.(17.13±2.04) mg/L], ICAM-1 [(81.23±19.83) pg/ml vs.(64.31±15.46) pg/ml] and ET-1 [(1.45±0.34) pg/ml vs.(0.87±0.23) pg/ml], and significant rise in NO level [(53.27±5.31) mmol/L vs.(58.72±5.46) mmol/L], LVEF [(52.37±5.38)% vs.(63.19±5.79)%] and CO [(4.58±0.78) L/min vs.(5.13±0.82) L/min] in atorvastatin group, P<0.01 all.Compared with routine treatment group, there were significant rise in total effective rates of angina pectoris (73.22% vs.89.29%) and ECG (66.07% vs.83.93%) in atorvastatin group, P<0.05 both.There were no serious adverse drug reactions in two groups.Conclusion: Atorvastatin can significantly improve inflammation state and vascular endothelial function in patients with coronary heart disease.
5.Clinical observation on hemodialysis in treating 60 cases of acute kidney injury caused by bee sting
Hong TAO ; Ling WANG ; Xiaolan LI ; Yuping LAN ; Xingchao RUAN ; Qiu LI
Chongqing Medicine 2013;(27):3260-3261
Objective To summarize the clinical features of bee sting caused aute kidney injury in children and the effect of he-modialysis therapy .Methods 60 children cases of bee sting caused acute renal injury were performed the retrospective analysis on the clinical features and laboratory data .Results Cystatin C ,serum creatinine ,blood urea nitrogen in children patients with acute kidney injury after hemodialysis were significantly decreased ,while procalcitonin ,high-sensitivity C-reactive protein ,acidosis and e-lectrolyte imbalance also were corrected or improved .After hemodialysis in 60 children cases ,45 cases were clinically cured ,13 cases were significantly improved and discharged and 2 cases died .Conclusion Bee sting is most likely to result in children acute renal in-jury .Hemodialysis is safe and effective treatment measures for acute kidney injury ,can actively improve the renal function without significant complications of acid-base balance and electrolyte imbalance .But the prognosis is closely related with the onset age of the aute kidney injury ,injury severity ,where or not accompanied by MOF ,opportunity of diagnose and treatment ,etc .
6.Introduction of postgraduate clinical education system for oral surgeons in Japan
Xiangjun LI ; Guiyun REN ; Xudong ZHANG ; Fuliang HAO ; Xingchao LI ; Tiepeng XIAO
Chinese Journal of Medical Education Research 2013;(3):260-263
Taking Shinshu University of Japan for example,we attempted to introduce the postgraduate clinical education system for new oral surgeons by analyzing the management of clinical training programs,studies of oral maxillofacial and associated medicine,and practices of scientific research in the department of oral surgery.Their experiences may be useful for us to improve our medical continuing education for young oral surgery residences.
7.Establishment of a multiplex real time quantitative PCR method for CMV promoter nucleic acid sequences detection
Yufa MIAO ; Sanlong WANG ; Xiaobing ZHOU ; Yan HUO ; Xingchao GENG ; Jianjun LYU ; Jufeng WANG ; Bo LI
Chinese Journal of Pharmacology and Toxicology 2014;(2):296-301
OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.
8.Intra-articular injection of platelet-rich plasma for treatment of knee osteoarthritis: a prospective,randomized, controlled trial
Shuaijie LYU ; Ju LI ; Bin HE ; Liming YI ; Hongting JIN ; Xingchao SHEN ; Peijian TONG
Chinese Journal of Trauma 2016;32(7):626-631
Objective To study the clinical efficacy of platelet-rich plasma (PRP) in the treatment of knee osteoarthritis (KOA) and evaluate whether the age,body mass index and grade of KOA are associated with the treatment outcomes.Methods Using the prospective,randomized,controlled study,100 KOA patients hospitalized between December 2013 and November 2014 were enrolled.Twentyeight patients were men and 72 were women.Mean age was 58 years (range,35-85 years).Degenerative arthritis occurred in 68 patients and traumatic arthritis in 32 patients.Kellgren-Lawrence (K-L) score was grade Ⅱ in 35 patients,grade Ⅱ in 46 and grade Ⅲ in 19.The patients were assigned to receive hyaluronic acid (HA) (HA group,n =50) and PRP (PRP group,n =50) by an intraarticular route once weekly for 3 weeks,according to the random number table.Between-group differences were insignificant in age,gender,body mass index (BMI) and K-L grade.Western Ontario and McMaster Universities Arthritis Index (WOMAC),visual analog scale (VAS) and cartilage lesions score (CaLs) were used for clinical and MRI evaluations.At follow-up evaluation,the effective rate was defined at least 36% improvement from the baseline WOMAC score.Results All patients were followed up for 6 months.The effective rate in PRP group was 84% versus 68% in HA group after the last treatment (P >0.05),and was 60% versus 36% in HA group at the final follow-up (P < 0.05).WOMAC score in both groups had significant improvement after operation,while VAS improved only in PRP group (P < 0.01).In PRP group patients with K-L grade I had better VAS and WOMAC scores than those with grade Ⅱ (P <0.05),and patients with grade Ⅱ had better WOAMC score than those with grade Ⅲ (P < 0.05).MRI findings showed seven patients in PRP group had similar CaLs before and after operation (P > 0.05),and the area of abnormal signal in subchondral bone and the depth of cartilage lesion gradually decreased in one of them.Follow-up study showed the outcomes had negative correlation with age and K-L grade (P <0.05),but no certain correlation with BMI in PRP group (P > 0.05).Clinical effects in both groups were decreased over time.Conclusions Intraarticular injection of PRP benefits to pain relief,decreased inflammation and tissue repair,and has much better outcome in patients with younger age and lower K-L grade.However,BMI is not associated with the outcome.
9.Effect of laparoscopic minimally invasive surgery on immune function in patients with gastric cancer and its clinical efficacy
Clinical Medicine of China 2017;33(11):977-981
Objective To analyze the effect of laparoscopic minimally invasive surgery on the immune function of patients with gastric cancer and its clinical efficacy.Methods A total of eighty patients with gastric cancer treated in the First Affiliated Hospital of Hainan Medical University from February 2012 to February 2017 were retrospectively selected.According to the different surgical methods the patients were divided into laparoscopic group and laparotomy group.The laparotomy group was treated with open radical gastrectomy,and the laparoscopic group was treated with laparoscopic radical gastrectomy.The operation and postoperative condition,complications,immune indexes and changes of gastrointestinal hormone levels in the two groups were observed.Results The operation time of the endoscopic group was(198.64±43.89)min,longer than that in the laparotomy group((152.01 ± 42.11)min),the incision size((5.79 ± 1.54)cm),blood loss((75.20 ±11.36)ml)and hospitalization time((8.12±1.58)d)were less than those in the control group((15.96 ±1.55)cm,(129.21±12.03)ml,(12.33±1.85)d)(t=4.849,29.428,20.645,10.944; P<0.05).There was no significant difference in the number of lymph node dissection between the two groups(P>0.05).The CD3,CD4,CD8 and CD4 /CD8 in the laparotomy group three days after the treatment were lower than those after treatment in the endoscopic group((51.90 ± 3.66)% vs.(62.01 ± 3.02)%;(30.25 ± 3.98)% vs.(41.13 ±4.79)%;(23.01±4.02)% vs.(28.20 ± 4.15)%;(0.93 ± 0.21)% vs.(1.19 ± 0.20)%)(t=13.475, 11.049,5.681,5.670,P<0.05).No significant difference was showed between the levels of immune indexes before and after treatment in the endoscopic group(P>0.05).The VIP in the laparotomy group 3d after the treatment was higher than those before treatment and in the laparoscopic group after treatment,MTL and SS were lower than those before treatment and in the endoscopic group after treatment(t=1.707,2.713,4.409,1.756, 2.488,3.969;P<0.05).There was no significant difference in the levels of gastrointestinal hormones before and after treatment in the endoscopic group(P>0.05).The complication rate in the endoscopic group was 10% and 27.50% in the laparotomy group,and the complication rate in the endoscopic group was lower than that in the laparotomy group(χ2=4.021;P<0.05).Conclusion Laparoscopic radical gastrectomy has the advantages of less trauma,less bleeding loss and less complications.It also has little effect on the immune function and gastrointestinal hormones,which is beneficial to the recovery of postoperative patients.
10.Mini-implant stability analysis at different healing times before loading.
Lihua SHAN ; Guanjun ZHOU ; Xingchao LI
West China Journal of Stomatology 2013;31(6):557-560
OBJECTIVEThis study aims to biomechanically analyze a mini-implant at different healing times before loading.
METHODSSixty-four mini-implants with (12 +/- 1) N x cm insertion torque were placed in the low jaw of eight beagle dogs. The test mini-implants remained in the low jaw for 0, 1, 3, and 8 weeks of bone healing and for an additional 10 weeks under a force of 0.98 N. The unloaded control implants were further divided into four groups (1, 3, 8, and 10 weeks). Maximum removal torque (MRT) testing was performed to evaluate the interfacial share strength of each group. Surface analysis of the removed implants was performed by scanning electric microscope (SEM).
RESULTSThe MRT for the loading implants at 0, 1, 3, and 8 weeks of healing were 4.10, 4.25, 2.42, and 4.42 N x cm, respectively. During the healing process, the removal torque values of the 3-week implants were significantly lower than those of the other healing groups (P < 0.05). The unloaded 3-week implants also had lower removal torques (P < 0.05). The implant surface of the 3-week test group showed more fibrous bone. However, the other loading implants had more lamellar-like tissue.
CONCLUSIONA stable dangerous period occurred approximately 3 weeks after mini-implant insertion. A 3-week healing is disadvantageous to the stability of the implant. Orthodontics loading occurred immediately or after 1 week as a function of the healing time. The 8-week implant appeared to have a positive effect on peri-implant bone remodeling and implant stability.
Animals ; Bone Remodeling ; Dental Implants ; Dogs ; Orthodontic Anchorage Procedures ; Osseointegration ; Torque ; Wound Healing