1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Discriminating Tumor Deposits From Metastatic Lymph Nodes in Rectal Cancer: A Pilot Study Utilizing Dynamic Contrast-Enhanced MRI
Xue-han WU ; Yu-tao QUE ; Xin-yue YANG ; Zi-qiang WEN ; Yu-ru MA ; Zhi-wen ZHANG ; Quan-meng LIU ; Wen-jie FAN ; Li DING ; Yue-jiao LANG ; Yun-zhu WU ; Jian-peng YUAN ; Shen-ping YU ; Yi-yan LIU ; Yan CHEN
Korean Journal of Radiology 2025;26(5):400-410
Objective:
To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer.
Materials and Methods:
A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs.
Results:
All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027).
Conclusion
The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.
3.Influencing factors of neonatal red blood cell transfusion: a retrospective analysis
Na ZHOU ; Xin HE ; Yu SI ; Chen HOU ; Jialu CHEN ; Zhaohui TANG
Chinese Journal of Blood Transfusion 2025;38(3):375-381
[Objective] To analyze the effects of different factors and red blood cell transfusion thresholds on the efficacy of neonatal red blood cell (RBC) transfusion, in order to provide more references for neonatal transfusions to better achieve rational and effective blood use. [Methods] A retrospective collection of data from 282 neonates who received RBC transfusions at our hospital from 2022 to 2023 was conducted, including birth weight, gestational age, number of blood transfusions, length of hospital stay, assisted ventilation during RBC transfusion, and laboratory test results before and after transfusion. SPSS software was used for statistical analysis to comprehensively analyze the impact of different factors on the efficacy of RBC transfusion in neonates. [Results] The results showed that the gestational age and weight of newborns at birth were negatively correlated with their length of hospital stay and the number of RBC transfusions during hospitalization. Newborns with younger gestational age and lower weight had longer hospital stays and more RBC transfusions during hospitalization. After administering RBCs according to the standard of 15 mL/kg, there was a statistically significant difference in the efficacy of RBC transfusion at different transfusion thresholds. In non-critical situations, RBC transfusions were ineffective when the pre-transfusion hemoglobin (Hb) level was >120 g/L. When the pre-transfusion Hb level was ≤70 g/L, RBC transfusions achieved higher efficacy in both critical and non-critical situations. [Conclusion] In critical situations, the group with pre-transfusion Hb values ≤ 70 g/L has the best RBC transfusion effect, while in non-critical situations, the group with pre-transfusion Hb levels between 81 and 90 g/L has the best RBC transfusion effect. Overall, the efficacy of RBC transfusion in non-critical situations is higher than that in critical situations.
4.Effects of intravenous and intraperitoneal routes on Babesia microti infections and splenic immune cells in BALB/c mice
Hanyin YANG ; Yuchun CAI ; Shuning YAN ; Yi XIN ; Ziran MO ; Bin XU ; Bin ZHENG
Chinese Journal of Schistosomiasis Control 2025;37(1):61-68
Objective To investigate the changes in the prevalence of Babesia microti infections, spleen morphology and proportions of splenic immune cells in BALB/c mice following intravenous and intraperitoneal injections, so as to provide insights into unraveling the immune regulatory mechanisms of Babesia infections. Methods Laboratory - maintained B. microti strains were prepared into whole blood samples with 10% prevalence of B. microti infection. A total of 75 BALB/c mice were randomly divided into three groups, including the normal control group, intravenous injection group, and intraperitoneal injection group, of 25 mice in each group. Mice in the intravenous and intraperitoneal injection groups were administered 100 μL of whole blood samples with 10% prevalence of B. microti infection, with the day of injection recorded as d0, and animals in the normal control group were given no treatments. Blood was sampled from mice in each group via the tail tip on d7, d14, d21, d28 and d35, and prepared into thin-film blood smears, and B. microti infection was observed in red blood cells. Five mice were randomly sampled from each group and sacrificed on d7, d14, d21, d28 and d35, and spleen was collected for measurement of spleen size and weight. In addition, splenic cells were isolated, and the proportions of CD3e+ T cells, CD45R+ B cells, CD49b+ nature killer (NK) cells, and F4/80+ macrophages were detected in CD45+ lymphocytes using flow cytometry. Results The prevalence of B. microti infection in the intravenous (22.80%) and intraperitoneal injection groups (44.82%) peaked on d7 (χ2 = 8.141, P < 0.01) and then rapidly decreased, and no parasites were observed on d35. The longest mouse spleen length [(32.91 ± 2.20) mm] and width [(9.82 ± 0.43) mm], and the greatest weight [(0.78 ± 0.10) g] were found on d14 in the intravenous injection group, and the longest spleen length [(32.42 ± 3.21) mm] and width [(10.25 ± 0.73) mm], and the greatest weight [(0.73 ± 0.09) g] were seen in the intra-peritoneal injection group on d21, d7 and d14, respectively. There were significant differences among the intravenous injection group, intraperitoneal injection group and the normal control group in terms of spleen length (F = 10.310, P < 0.05), width (F = 9.824, P < 0.05), and weight (F = 10.672, P < 0.05) on d21, and the mouse spleen length, width and weight were all significantly greater in the intraperitoneal injection group than in the intravenous injection group (allP values < 0.05). The proportions of splenic CD3e+ T cells [(60.60 ± 6.20)% and (39.68 ± 7.62)%], CD45R+ B cells [(43.32 ± 2.08)% and (49.53 ± 4.90)%], CD49b+ NK cells [(6.88 ± 1.34)% and (7.71 ± 1.59)%], and F4/80+ macrophages [(2.21 ± 0.29)% and (3.80 ± 0.35)%] peaked on d14, d21, d21 and d14 in the intravenous and intraperitoneal injection groups, respectively. There were significant differences in the proportions of CD3e+ T cells (F = 16.730, P < 0.05) and F4/80+ macrophages (F = 15.941, P < 0.05) among the intravenous injection group, intraperitoneal injection group and normal control group on d14, and a higher proportion of CD3e+ T cells and a lower proportion of F4/80+ macrophages were detected in the intravenous injection group than in the intraperitoneal injection group (both P values < 0.01). There were significant differences among the intravenous injection group, intraperitoneal injection group and normal control group on d21 in terms of proportions of splenic CD3e+ T cells (F = 9.252, P < 0.05), CD45R+ B cells (F = 14.349, P < 0.05), CD49b+ NK cells (F = 13.436,P < 0.05), and F4/80+ macrophages (F = 8.180, P < 0.05), and a higher proportion of CD3e+ T cells and lower proportions of CD45R+ B cells and F4/80+ macrophages were detected in the intravenous injection group than in the intraperitoneal injection group (all P values < 0.01). In addition, there was a significant difference in the proportion of CD3e+ T cells among the intravenous injection group, intraperitoneal injection group and normal control group on d28 (F = 9.772,P < 0.05), and a lower proportion of CD3e+ T cells was found in the intravenous injection group than in the intraperitoneal injection group (P < 0.01). Conclusions Both intraperitoneal and intravenous routes are effective to induce B. microti infections in BALB/c mice, and the prevalence of B. microti infections is higher in BALB/c mice through the intraperitoneal route than through the intravenous route. Intraperitoneal and intravenous injections with B. microti cause diverse spleen morphologies and proportions of splenic immune cells in mice, indicating routes of B. microti infections cause different impacts on immune response mechanisms in mice.
5.Serological characteristics of hemolytic transfusion reactions caused by Rh and Kidd antibodies
Qunjuan ZENG ; Hecai YANG ; Xi LI ; Yulin QIAN ; Xin JIAO
Chinese Journal of Blood Transfusion 2025;38(4):551-556
[Objective] To retrospectively analyse the serological characteristics of hemolytic transfusion reactions caused by Rh and Kidd antibodies, and to provide reference for safe, timely, and effective blood transfusion. [Methods] Two cases of patients with RhCcEe and Kidd blood type who experienced allogeneic transfusion at Dazhou Central Hospital were selected. A series of immunohematological tests were performed, including ABO, RhDCcEe and Kidd blood typing, unexpected antibody screening and identification, crossmatching, direct antiglobulin test, acid elution test, and capillary centrifugation to separate the patient's own red blood cells from donated red blood cells. [Results] Unexpected antibody screening, antibody identification, and direct antiglobulin test were positive in both patients. Case 1 had anti-Jk
in the plasma, but no specific antibodies were found in the eluate. Case 2 had anti-c and E in the plasma, and anti-E was detected in the eluate. High-speed capillary centrifugation revealed corresponding antigen-positive erythrocytes at the distal end of the blood samples of both patients. [Conclusion] Case 1 received Kidd allogeneic red blood cells, and case 2 received RhCcEe allogeneic red blood cells, and both patients developed the corresponding unexpected antibodies, which led to the occurrence of immune haemolytic blood transfusion reaction.
6.Clinical Efficacy of Zhuyuwan in Treatment of Hyperlipidemia with Syndrome of Phlegm Turbidity and Obstruction
Lele YANG ; Danmei LUO ; Jiao CHEN ; Xiaobo ZHANG ; Wei SONG ; Wenyu ZHU ; Xin ZHOU ; Xueping LI ; Tao SHEN
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(13):29-37
ObjectiveTo observe the clinical efficacy and safety of Zhuyuwan in the treatment of hyperlipidemia. MethodsIn this study, hyperlipidemia patients treated in the Hospital of Chengdu University of Traditional Chinese Medicine (TCM) from September 2022 to December 2023 were randomly assigned into a control group and an observation group. Finally, 162 valid cases were included, encompassing 74 cases in the control group and 88 cases in the observation group. The control group was treated with atorvastatin calcium tablets, and the observation group with atorvastatin calcium tablets + Zhuyuwan extract granules. Both groups were treated for 8 weeks. The efficacy in terms of blood lipid level recovery, blood lipid levels, TCM syndrome distribution, efficacy in terms of TCM syndrome, and TCM symptom scores were compared between the two groups as well as between before and after treatment. Liver and kidney functions were monitored for safety assessment. ResultsIn terms of blood lipid level recovery, the total response rate in the observation group was 86.36% (76/88) and that in the control group was 86.49% (64/74), with no statistically significant difference between the two groups. After treatment, both groups showed declines in levels of triglyceride (TG), total cholesterol (TC), and low-density lipoprotein cholesterol (LDL-C) (P<0.05) and elevations in the level of high-density lipoprotein cholesterol (HDL-C) (P<0.05). Moreover, the observation group outperformed the control group in recovering the levels of TG, LDL-C, and HDL-C (P<0.05, P<0.01). In terms of TCM syndrome, hyperlipidemia was mostly caused by phlegm turbidity and obstruction. The total response rate in terms of TCM syndrome in the observation group was 87.30% (55/63), which was higher than that (63.46%, 33/52) in the control group (χ2=9.102, P<0.01). After treatment, the scores of total TCM symptoms, primary symptoms, and secondary symptoms decreased in both groups (P<0.05), and the observation group had lower scores than the control group (P<0.01). The observation group was superior to the control group in alleviating obesity, chest tightness, and low food intake (P<0.05). In terms of safety, the level of aminotransferase was slightly elevated in the control group, and no obvious adverse reaction was observed in the observation group, with no statistical significance in the incidence of adverse reactions. ConclusionZhuyuwan combined with atorvastatin can not only recover blood lipid levels and alleviate TCM symptoms but also reduce the occurrence of adverse reactions.
7.Clinical Efficacy of Zhuyuwan in Treatment of Hyperlipidemia with Syndrome of Phlegm Turbidity and Obstruction
Lele YANG ; Danmei LUO ; Jiao CHEN ; Xiaobo ZHANG ; Wei SONG ; Wenyu ZHU ; Xin ZHOU ; Xueping LI ; Tao SHEN
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(13):29-37
ObjectiveTo observe the clinical efficacy and safety of Zhuyuwan in the treatment of hyperlipidemia. MethodsIn this study, hyperlipidemia patients treated in the Hospital of Chengdu University of Traditional Chinese Medicine (TCM) from September 2022 to December 2023 were randomly assigned into a control group and an observation group. Finally, 162 valid cases were included, encompassing 74 cases in the control group and 88 cases in the observation group. The control group was treated with atorvastatin calcium tablets, and the observation group with atorvastatin calcium tablets + Zhuyuwan extract granules. Both groups were treated for 8 weeks. The efficacy in terms of blood lipid level recovery, blood lipid levels, TCM syndrome distribution, efficacy in terms of TCM syndrome, and TCM symptom scores were compared between the two groups as well as between before and after treatment. Liver and kidney functions were monitored for safety assessment. ResultsIn terms of blood lipid level recovery, the total response rate in the observation group was 86.36% (76/88) and that in the control group was 86.49% (64/74), with no statistically significant difference between the two groups. After treatment, both groups showed declines in levels of triglyceride (TG), total cholesterol (TC), and low-density lipoprotein cholesterol (LDL-C) (P<0.05) and elevations in the level of high-density lipoprotein cholesterol (HDL-C) (P<0.05). Moreover, the observation group outperformed the control group in recovering the levels of TG, LDL-C, and HDL-C (P<0.05, P<0.01). In terms of TCM syndrome, hyperlipidemia was mostly caused by phlegm turbidity and obstruction. The total response rate in terms of TCM syndrome in the observation group was 87.30% (55/63), which was higher than that (63.46%, 33/52) in the control group (χ2=9.102, P<0.01). After treatment, the scores of total TCM symptoms, primary symptoms, and secondary symptoms decreased in both groups (P<0.05), and the observation group had lower scores than the control group (P<0.01). The observation group was superior to the control group in alleviating obesity, chest tightness, and low food intake (P<0.05). In terms of safety, the level of aminotransferase was slightly elevated in the control group, and no obvious adverse reaction was observed in the observation group, with no statistical significance in the incidence of adverse reactions. ConclusionZhuyuwan combined with atorvastatin can not only recover blood lipid levels and alleviate TCM symptoms but also reduce the occurrence of adverse reactions.
8.Discriminating Tumor Deposits From Metastatic Lymph Nodes in Rectal Cancer: A Pilot Study Utilizing Dynamic Contrast-Enhanced MRI
Xue-han WU ; Yu-tao QUE ; Xin-yue YANG ; Zi-qiang WEN ; Yu-ru MA ; Zhi-wen ZHANG ; Quan-meng LIU ; Wen-jie FAN ; Li DING ; Yue-jiao LANG ; Yun-zhu WU ; Jian-peng YUAN ; Shen-ping YU ; Yi-yan LIU ; Yan CHEN
Korean Journal of Radiology 2025;26(5):400-410
Objective:
To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer.
Materials and Methods:
A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs.
Results:
All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027).
Conclusion
The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.
9.Discriminating Tumor Deposits From Metastatic Lymph Nodes in Rectal Cancer: A Pilot Study Utilizing Dynamic Contrast-Enhanced MRI
Xue-han WU ; Yu-tao QUE ; Xin-yue YANG ; Zi-qiang WEN ; Yu-ru MA ; Zhi-wen ZHANG ; Quan-meng LIU ; Wen-jie FAN ; Li DING ; Yue-jiao LANG ; Yun-zhu WU ; Jian-peng YUAN ; Shen-ping YU ; Yi-yan LIU ; Yan CHEN
Korean Journal of Radiology 2025;26(5):400-410
Objective:
To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer.
Materials and Methods:
A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs.
Results:
All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027).
Conclusion
The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.
10.Optimization of Ovarian Tissue Vitrification Using Hydrogel Encapsulation and Magnetic Induction Nanowarming
Yu-Kun CAO ; Na YE ; Zheng LI ; Xin-Li ZHOU
Progress in Biochemistry and Biophysics 2025;52(2):464-477
ObjectiveFor prepubertal and urgently treated malignant tumor patients, ovarian tissue cryopreservation and transplantation represent more appropriate fertility preservation methods. Current clinical practices often involve freezing ovarian tissue with high concentrations of cryoprotectants (CPAs) and thawing with water baths. These processes lead to varying degrees of toxicity and devitrification damage to ovarian tissue. Therefore, this paper proposes optimized methods for vitrification of ovarian tissues based on sodium alginate hydrogel encapsulation and magnetic induction nanowarming technology. MethodsFirstly, the study investigated the effects of sodium alginate concentration, the sequence of hydrogel encapsulation and CPAs loading on vitrification efficiency of encapsulated ovarian tissue. Additionally, the capability of sodium alginate hydrogel encapsulation to reduce the required concentration of CPAs was validated. Secondly, a platform combining water bath and magnetic induction nanowarming was established to rewarm ovarian tissue under various concentrations of magnetic nanoparticles and magnetic field strengths. The post-warming follicle survival rate, antioxidant capacity, and ovarian tissue integrity were evaluated to assess the efficacy of the method. ResultsThe study found that ovarian tissue encapsulated with 2% sodium alginate hydrogel exhibited the highest follicle survival rate after vitrification. The method of loading CPAs prior to encapsulation proved more suitable for ovarian tissue cryopreservation, effectively reducing the required concentration of CPAs by 50%. A combination of 8 g/L Fe3O4 nanoparticles and an alternating magnetic field of 300 Gs showed optimal warming effectiveness for ovarian tissue. Combining water bath rewarming with magnetic induction nanowarming yielded the highest follicle survival rate, enhanced antioxidant capacity, and preserved tissue morphology. ConclusionSodium alginate hydrogel encapsulation of ovarian tissue reduces the concentration of CPAs required during the freezing process. The combination of magnetic induction nanowarming with water bath provides an efficient method ovarian tissue rewarming. This study offers novel approaches to optimize ovarian tissues vitrification.

Result Analysis
Print
Save
E-mail