BACKGROUND: With the rapid development of tissue engineering, a single biological scaffold material is hard to meet the needs of tissue engineering. Therefore, composite scaffolds with excellent performance will be obtained by combining two or more kinds of materials.OBJECTIVE: To detect the adherence and proliferation of dental pulp stem cells on the Chitosan-fibrin composite scaffold.METHODS: Dental pulp stem cells were isolated and extracted from C57 neonatal rats through modified enzyme-digestion method, and subcultured to the third generation, followed by adipogenic and osteogenic induction in vitro. Then, induced cells were identified. The chitosan-fibrinogen composite scaffold was prepared, and the pore size and porosity were determined. The chitosan-fibrin composite scaffold was co-cultured with passage 3 dental pulp stem cells to observe the cell proliferation by MTT assay, and the morphology of the composite scaffold, cell adhesion,proliferation and extracellular matrix secretion were observed under scanning electron microscope. In addition, the cells were inoculated directly on the bottom of culture plate as controls.RESULTS AND CONCLUSION: The dental pulp stem cells were successfully isolated and cultivated, and positive for osteogenic and adipogenic differentiation. The pore size and porosity of the composite scaffold was (105.32±22.10) μm and (87.714±1.276)%, respectively. The S-shaped proliferation curve in the experimental group was similar with that in the control group; the proliferation rate in the experimental group was significantly higher than that in the control group after 4-8 days of culture (P < 0.05). At the 2nd day after co-culture, the cells adhered tightly and grew well onto the composite scaffold; at the 4th day, enlarged cells began to proliferate obviously with abundant extracellular matrix; the surface and pores of the scaffold were full of cells at the 6th day. These results indicate that the chitosan-fibrin composite scaffold is suitable for the adhesion and proliferation of dental pulp stem cells.

Objective: To observe the effects of Radix Glycyrrhizae polysaccharide on regulatory T cells (Treg) in spleen and lymphocyte transformation ratio in tumor-bearing mice so as to explore the mechanisms of its immunoregulatory function. Methods: Fifty BALB/c mice were randomly divided into normal group, untreated group, cyclophosphamide group, Radix Glycyrrhizae polysaccharide group and Radix Glycyrrhizae polysaccharide plus cyclophosphamide group. Except normal group, mice were subcutaneously implanted H22 tumor cells in the right axillary region. After 24 h, mice in normal and untreated group were subcutaneously injected with physiological saline, while mice in the cyclophosphamide group were intraperitoneally injected with cyclophosphamide and mice in Radix Glycyrrhizae polysaccharide group were subcutaneously injected with polysaccharide. Fourteen days later, Treg cells of spleen were detected by flow cytometry and lymphocyte transformation ratio was detected by methyl thiazolyl tetrazolium method. Results: The proportion of Treg cells was significantly higher in the untreated group than in the normal group, and was lower in the Radix Glycyrrhizae polysaccharide group than in the untreated group (P

Objective:To investigate the expressions of Mfn2(mitofusin 2) in non-small-cell lung cancer (NSCLC) tissues and non-cancerous lung tissues,and analyze its relationship with clinicopathological characteristics of lung carcinomas.Methods:The expressions of Mfn2 mRNA and protein in 92 cases of NSCLC tissues and 27 cases of non-cancerous lung tissues were detected by in situ hybridization and immunohistochemical methods. Results:The positive rates of Mfn2 mRNA and protein in pulmonary squamous cell carcinoma were higher than those in adenocarcinoma (83.33% and 89.58% vs 56.82% and 65.91%), respectively. The positive rates of Mfn2 mRNA and protein in NSCLC were higher than those in the non-cancerous lung tissues (25.93% and 29.63%) . The difference was statistically significant among the three groups (P<0.001 and P<0.01). The expressions of Mfn2 mRNA and protein in well-differentiated (93.75% and 100%) and moderately-differentiated NSCLC (91.67% and 91.67%) were higher than those in poor-diffe-rentiated NSCLC (21.43% and 42.86%). The difference was significant (P<0.001). The expressions of Mfn2 mRNA and protein had no correlation with the gender, age, tumor size, TNM stage and lymph node metastasis (P>0.05). The expression of Mfn2 mRNA was consistent with that of Mfn2 protein in NSCLC.Conclusion:Mfn2 was involved in the initiation and progression of lung cancer, and the expression of Mfn2 was related to the histological types of lung cancer and its differentiation degree.

OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.

Objective To identify the cross-reactive antigens shared by Mycobacteria smegmatis(MS) and Mycobacteria tuberculosis(MTB) and to analyze their antigenicity.Methods Bacterial antigens were extracted from strains of MS and MTB by ultrasonication.Western blot assay was performed to analyze common antigens that reacted with both of the antiserum samples against MS and MTB.The extracted bacterial antigens were mixed with incomplete Freund′s adjuvant and then were injected into muscles of mice.Cytokines secreted by murine spleen lymphocytes following stimulation with various antigens of MS and MTB were determined by ELISPOT and flow cytometry on the 7th day.IgG levels in serum samples were detected by ELISA 7 days after injection.Results There were cross-reactive antigens shared by MS and MTB.Potent humoral immune responses and cellular immunity against both MS and MTB could be induced by those cross-reactive antigens after sensitization the mice by either MS or MTB antigens.Cytokines of IL-2 and IFN-γ in CD4+ and CD8+T cells of mice stimulated with MS or MTB antigens were significantly increased as compared with those of non-sensitization group and those of Brucella antigens stimulation group.ConclusionCross-reactive antigens shared by MS and MTS can effectively promote specific immune reactions to the infection of MTB, which provides a scientific basis for the development of tuberculosis vaccines.

Objective To establish a guinea pig model of latent Mycobacterium tuberculosis infec-tion for evaluating the effects of therapeutic vaccines .Methods Guinea pigs were subcutaneously inocula-ted with 5.0×103 CFU Mtb.The skin test was performed with 0.5μg recombinant ESAT6-CFP10 protein to detect positive conversion rates at different time points .Two weeks after Mtb inoculation , guinea pigs in model group received 5 mg isoniazid treatment ( three times a week for four weeks ) by oral gavage , while those in control group received normal saline .At the sixth week after Mtb infection , guinea pigs with and without isoniazid treatment were dissected for pathology examination .The pathological scores of liver , spleen and lung, as well as bacteria loads in spleen were compared between two groups .The established guinea pig model of latent infection was then validated by testing two reference vaccines ( AEC/BC02 and AEC/BC03 ) . Results Two weeks after Mtb inoculation , all guinea pigs showed positive EC skin test with induration area of (19.9±3.0) mm.Upon four weeks of isoniazid treatment , the guinea pigs in model group showed no pathological changes with zero scores in the examined organs .No bacterium was detected in spleen of ani-mals from model group.However, the total pathological score was 38.8±16.5 and bacteria load in spleen was (5.1±0.3) Log10 CFU with the guinea pigs from control group .Natural recurrence of tuberculosis in model group was observed after drug withdrawal .The total pathological scores were 48.5±23.9 and 51.3± 23.41.The bacterial loads in spleen were (4.5±1.3) and (4.2±1.1) Log10 CFU and bacterial loads in lung were (4.1±1.2) and (3.4±1.3) Log10 CFU respectively as verified with reference vaccines of AEC /BC02 and AEC/BC03.Conclusion Isoniazid treatment inhibited the proliferation of inoculated Mtb in guinea pigs.A guinea pig model of latent Mycobacterium tuberculosis infection is successfully established with an advantage of good repeatability .Therefore, it can be used to evaluate the effects of therapeutic vaccines on latent Mycobacterium tuberculosis infection.

Objective To establish a suitable guinea pig model for evaluating the protective effects of new TB vaccines in BCG prime-boost regimen .Methods Two different immunization strategies by using the recombinant TB vaccine were employed to boost BCG primed guinea pigs in this study .One was for short-term evaluation with 14 weeks interval between prime and boost immunization and another was for long -term evaluation with 54 weeks interval .In the short-term evaluation group , guinea pigs were boosted twice with the recombinant TB vaccine ( AEC/BC02 ) in every two weeks , while guinea pigs in the long-term evaluation group were boosted for three times with two weeks interval between each injection .A negative con-trol group ( NS→NS) and a BCG control group ( BCG→NS) were both set up in two evaluation groups .One week after the last immunization , all guinea pigs were challenged with M.tuberculosis.Six to seven weeks after bacteria challenge , all animals were euthanized and dissected to evaluate lesion scores of liver , spleen and lung, as well as the viable bacterial load in spleen .Results In the short-term evaluation group , the le-sion scores in those boosted with vaccine (3.33±5.00) was lower than that of BCG control group (5.56± 7.27) (P>0.05) and negative control group (47.00±28.11) (P=0.0001).The difference between BCG control group and negative control group in lesion score was also significant .The animals in vaccine boosted group had lower bacterial loads (0.78±1.55 log10 ) in spleen than that in BCG control group (1.06±1.87) (P>0.05) and negative control group (5.47±0.61) (P=0.0003).In the long-term evaluation group, the lesion score in those boosted with vaccine was lower (5.0±7.6) than that in BCG control group (14.4± 13.5) (P=0.0394) and negative control group (56.9±14.1) (P<0.0001).The animals in vaccine boos-ted group (1.00±1.86 log10) had lower bacterial loads in spleen than that in BCG control group (1.46± 1.94) (P>0.05) and negative control group (5.43±0.56) (P=0.01).There was a significant difference in bacterial load between BCG control group and negative group (P=0.0089).Conclusion The results suggest that the interval time between BCG-prime and boost immunization should be properly prolonged in the guinea pig model used for evaluating the protective effects of new TB vaccines in BCG prime -boost regimen .

In this study the treatment effect of combined implantation of autologous skin on pig dermis in injured rats was observed. Twenty-one Wistar rats were used, and the wounds were formed by excising a piece of full thickness skin on the back. After the pig dermis was implanted, the autologous skin was grafted on the dermis at 0.7 and 10 days. In the group with perforated pig dermis, the autograft skin was implanted on the day when the pig dermis was implanted. The healing effect was evaluated by measuring wound area, and by observing the growth of the autograft skin. Two weeks after the autograft skin was implanted, the skin securely adhered to the dermis, and the edge of autograft skin expanded clearly. The wound of the autograft skin implanted in the perforation of the dermis healed completely after 3 weeks, but the other 3 groups had remnant small wound. The autograft skin merged with the dermis and its surrounding tissue, but a clear dividing line still existed between autograft skin and dermis after implantation. The area of the implanted dermis and autograft skin varied from 51.8% to 65.9% compared to its original size. The results suggested that the time and the way of autologous skin grafting on xenogenous dermis may influence wound contraction and healing time.
Animals ; Dermis ; transplantation ; Female ; Graft Survival ; Male ; Rats ; Rats, Wistar ; Skin Transplantation ; methods ; Swine ; Swine, Miniature ; Transplantation, Autologous ; Transplantation, Heterologous

Objective:To investigate the multiple origin of retroperitoneal liposarcoma and its postoperative prognosis.Methods:A total of 49 retroperitoneal liposarcoma patients underwent total (ipsilateral) retroperitoneal lipectomy in our center from May 2017 to December 2019 were recruited. Clinical data and the follow-up information were reviewed and the origin and prognosis were analyzed.Results:A total of 15 patients were pathologically diagnosed as multiple primary cancer (MPC), the incidence rate of retroperitoneal liposarcoma with MPC was 30.6% (15/49), while other 34 cases was non-MPC. The postoperative recurrence rates of patients with high differentiation and de-differentiation retroperitoneal liposarcoma were 31.8% and 44.4%, without significant difference ( P>0.05). The postoperative recurrence rates of MPC and non-MPC were 40.0% and 38.2%, without significant difference ( P>0.05). Five cases died within the follow-up. Conclusion:Retroperitoneal liposarcoma might origin form MPC, and total (ipsilateral) retroperitoneal lipectomy is recommended to reduce the recurrence rate.

Objective:To investigate the multiple origin of retroperitoneal liposarcoma and its postoperative prognosis.Methods:A total of 49 retroperitoneal liposarcoma patients underwent total (ipsilateral) retroperitoneal lipectomy in our center from May 2017 to December 2019 were recruited. Clinical data and the follow-up information were reviewed and the origin and prognosis were analyzed.Results:A total of 15 patients were pathologically diagnosed as multiple primary cancer (MPC), the incidence rate of retroperitoneal liposarcoma with MPC was 30.6% (15/49), while other 34 cases was non-MPC. The postoperative recurrence rates of patients with high differentiation and de-differentiation retroperitoneal liposarcoma were 31.8% and 44.4%, without significant difference ( P>0.05). The postoperative recurrence rates of MPC and non-MPC were 40.0% and 38.2%, without significant difference ( P>0.05). Five cases died within the follow-up. Conclusion:Retroperitoneal liposarcoma might origin form MPC, and total (ipsilateral) retroperitoneal lipectomy is recommended to reduce the recurrence rate.