Aim To explore the mechanism of baicalin combined with heat stimulation in treating acute lym-phoblastic leukemia(ALL)based on network pharma-cology and in vitro experiments.Methods The CCK-8 assay was used to screen the suitable conditions for heat stimulation to interfere ALL cell lines Jurkat,CCRF-CEM,Hut-78 and a normal lymphocyte HMy2.CIR,and the effects of baicalin combined with heat stimulation on the proliferation of three ALL cell lines and a normal lymphocyte were tested.The key targets of baicalin combined with fever stimulation for the treatment of ALL were obtained based on network phar-macological analysis,and the potential mechanisms were predicted by gene ontology(GO)annotation and kyoto encyclopedia of genes and genomes(KEGG)en-richment.The expression levels of TNF-α,AKT1,TYMS and CASP3 mRNA in ALL cell lines Jurkat and CCRF-CEM were examined by RT-qPCR with baicalin alone and baicalin combined with heat stimulation.Results The optimal conditions for heat stimulation to intervene ALL cells were 41 ℃ for 24 h,and heat stimulation combined with baicalin synergistically inhibited the growth of ALL cell lines and effectively reduced the cy-totoxicity of baicalin.Based on the network pharmaco-logical analysis,55 intersecting targets of baicalin with ALL diseases and 77 intersecting targets of baicalin with fever were obtained.The results of GO annotation and KEGG enrichment suggested that baicalin com-bined with fever stimulation to intervene ALL might be associated with influencing intracellular reactive oxygen species metabolism,DNA transcription and apoptotic processes involved in cysteine enzymes.Apoptosis,TNF and IL-17 signaling pathways were the key pathways for baicalin combined with heat stimulation in treating ALL.Under heat stimulation at 41 ℃ using SDHA gene as housekeeping gene,in vitro experiments showed that baicalin significantly up-regulated the expression of TNF-α and CASP3,and down-regulated the expression of TYMS in ALL cells.Conclusions Based on net-work pharmacologic analyses and in vitro experiments,baicalin combined with heat stimulation can regulate TNF-α and CASP3 gene levels in ALL cells and de-stroy cellular structure to promote cell apoptosis,thus synergistically treating ALL.

Aim To investigate the role of FRMD4A in autophagy of placental trophoblast cells in preeclampsia(PE).Methods The placental tissues and clinical data of normal pregnancy and PE were obtained,and the histopathological changes were observed by HE staining.An in vitro model of hypoxia-induced HTR-8/SVneo trophoblast cells was established.The expres-sions of LC3B Ⅱ/Ⅰ and p62 in placental tissues and hypoxic cell models were analyzed by Western blot.The expression of FRMD4A was detected by qRT-PCR,Western blot and immunofluorescence,and the correlation between the expression level of FRMD4A and the clinical characteristics of the subjects was ana-lyzed by Pearson correlation analysis.Hypoxia induced trophoblast cells were transfected with si-FRMD4A,and the expression of LC3 B Ⅱ/Ⅰ and p62 was analyzed by Western blot.Results Compared with the normal group,the expression of LC3B Ⅱ/Ⅰ in PE placental tissues and hypoxia-induced trophoblast models was significantly upregulated,while the expression of p62 was significantly downregulated.Meanwhile,the ex-pression of FRMD4A increased significantly.Moreo-ver,its expression was positively correlated with the maternal systolic blood pressure,diastolic blood pres-sure,and platelet count,but negatively correlated with the neonatal weight(P＜0.01).In addition,hypoxia-induced trophoblast cells transfected with si-FRMD4A showed a significant decrease in LC3B Ⅱ/Ⅰ and an increase in p62 expression.Conclusions The expres-sion of FRMD4A is upregulated in PE placenta and hy-poxia-induced trophoblast cell model.Interfering with it can significantly hinder the autophagy process of trophoblast cells,suggesting that it may serve as a po-tential molecular target to participate in the pathologi-cal process of PE.

Objective To observe the clinical efficacy and safety of vericiguat tablets combined with sacubitril valsartan sodium(Sac/Val)tablets in the treatment of patients with heart failure with reduced ejection fraction(HFrEF).Methods The HFrEF patients were divided into control group and treatment group according to the cohort method.The control group was treated with Sac/Val tablets 200 mg per time,bid,orally.On the basis of control group,the treatment group was treated with vericiguat tablets 2.5 mg per time,qd,taken with meal.Two groups were treated for 3 months.The clinical efficacy,left ventricular ejection fraction(LVEF),left ventricular end-diastolic dimension(LVEDD)and end-systolic diameter(LVESD),levels of high sensitivity C-reactive protein(hs-CRP),interleukin-6(IL-6),nitric oxide(NO),N-terminal pro-brain natriuretic peptide(NT-proBNP),blood urea nitrogen(BUN)and serum creatinine(SCr),and safety were compared between the two groups.During follow-up,the heart failure rehospitalization rates and major adverse cardiovascular events were compared between the two groups.Results Treatment group was enrolled 53 patients,control group was enrolled 53 patients.After treatment,the total effective rates of treatment and control groups were 94.34％(50 cases/53 cases)and 81.13％(43 cases/53 cases)with statistical significant difference(P＜0.05).After treatment,the LVEF of treatment and control groups were(48.02±5.20)％and(43.02±4.33)％,the LVEDDs were(52.85±6.30)and(55.63±6.88)mm,the LVESDs were(41.64±6.40)and(44.22±5.85)mm,the levels of hs-CRP were(10.22±2.63)and(14.60±2.98)mg L-1,the levels of IL-6 were(14.48±2.40)and(17.36±2.52)pg·mL-1,the levels of NO were(102.60±20.16)and(92.16±16.33)μmol·L-1,the levels of NT-proBNP were(898.74±102.20)and(1315.60±182.64)ng·L-1,the levels of BUN were(12.02±2.28)and(13.45±2.33)mmol·L-1,the levels of SCr were(82.22±5.89)and(85.64±6.03)μmol·L-1,the heart failure rehospitalization rates were 5.66％and 13.21％,respectively;the differences were statistical significant between two groups(all P＜0.05).The adverse drug reactions of treatment group were hyperkalemia,hypotension,renal dysfunction,dizziness and headache,while those in control group were renal dysfunction,hyperkalemia,and hypotension.The major adverse cardiovascular events of treatment group were angina pectoris and acute myocardial infarction,while those in control group were angina pectoris,acute myocardial infarction and atrial fibrillation.The incidences of total adverse drug reactions in treatment and control groups were 13.21％and 7.55％,the incidences of major adverse cardiovascular events were 5.66％and 13.21％,respectively,without statistically significant differences(all P＞0.05).Conclusion Vericiguat tablets combined with Sac/Val tablets have a definitive clinical efficacy in the treatment of HFrEF patients,which can improve cardiac and endothelial function,reduce inflammatory response and readmission times,without increasing the incidences of adverse drug reactions.

This study was aimed at identifying the pathogenic bacteria responsible for the death of a young tiger at the Fujian Meihua Mountain South China Tiger Breeding Research Institute.Tissue samples from the lungs,liver,and intestines of the deceased tiger were collected,and the bacteria were cultured inasterile environment.The bacterial strains were characterized according to their morphological and molecular biological properties,including assessment of virulence genes and antibiotic resistance genes,mouse lethality tests,and antibiotic susceptibility evaluations.A predominant bacterial strain isolated from the liver of the deceased tiger was identified as enterotoxigenic Escherichia coli(ETEC)strain Tiger22513F.Phylogenetic analysis of the 16S rRNA gene revealed that the Tiger22513F strain exhibited close genetic similarity to the reference strain ETEC(MF919609.1),with 99.9%nucleotide similarity,and resided on the same evolutionary branch.The Tiger22513F strain contained 11 antibiotic resistance genes(tetA,sul1,sul3,cmlA,floR,blaTEM,blaSHV,blaCMY-2,qnrA,qnrS,and qnrD)along with five virulence genes(VT1,fyuA,tsh,iucD,and ST).Mouse lethality tests indicated significant pathogenicity toward mice,affecting primarily the lungs,liver,and intestines.Antibiotic susceptibility testing demonstrated that this strain exhibited resistance to various classes of beta-lactam antibiotics,as well as quinolones and aminoglycosides.This investigation successfully isolated a multi-drug resistant enterotoxigenic Escherichia coli strain with pronounced pathogenicity from the liver of a deceased tiger;thus providing valuable scientific insights for clinical diagnosis,as well as prevention and control measures,against ETEC infections in South China tigers.

This study was aimed at identifying the pathogenic bacteria responsible for the death of a young tiger at the Fujian Meihua Mountain South China Tiger Breeding Research Institute.Tissue samples from the lungs,liver,and intestines of the deceased tiger were collected,and the bacteria were cultured inasterile environment.The bacterial strains were characterized according to their morphological and molecular biological properties,including assessment of virulence genes and antibiotic resistance genes,mouse lethality tests,and antibiotic susceptibility evaluations.A predominant bacterial strain isolated from the liver of the deceased tiger was identified as enterotoxigenic Escherichia coli(ETEC)strain Tiger22513F.Phylogenetic analysis of the 16S rRNA gene revealed that the Tiger22513F strain exhibited close genetic similarity to the reference strain ETEC(MF919609.1),with 99.9%nucleotide similarity,and resided on the same evolutionary branch.The Tiger22513F strain contained 11 antibiotic resistance genes(tetA,sul1,sul3,cmlA,floR,blaTEM,blaSHV,blaCMY-2,qnrA,qnrS,and qnrD)along with five virulence genes(VT1,fyuA,tsh,iucD,and ST).Mouse lethality tests indicated significant pathogenicity toward mice,affecting primarily the lungs,liver,and intestines.Antibiotic susceptibility testing demonstrated that this strain exhibited resistance to various classes of beta-lactam antibiotics,as well as quinolones and aminoglycosides.This investigation successfully isolated a multi-drug resistant enterotoxigenic Escherichia coli strain with pronounced pathogenicity from the liver of a deceased tiger;thus providing valuable scientific insights for clinical diagnosis,as well as prevention and control measures,against ETEC infections in South China tigers.

Aim To investigate the role of FRMD4A in autophagy of placental trophoblast cells in preeclampsia(PE).Methods The placental tissues and clinical data of normal pregnancy and PE were obtained,and the histopathological changes were observed by HE staining.An in vitro model of hypoxia-induced HTR-8/SVneo trophoblast cells was established.The expres-sions of LC3B Ⅱ/Ⅰ and p62 in placental tissues and hypoxic cell models were analyzed by Western blot.The expression of FRMD4A was detected by qRT-PCR,Western blot and immunofluorescence,and the correlation between the expression level of FRMD4A and the clinical characteristics of the subjects was ana-lyzed by Pearson correlation analysis.Hypoxia induced trophoblast cells were transfected with si-FRMD4A,and the expression of LC3 B Ⅱ/Ⅰ and p62 was analyzed by Western blot.Results Compared with the normal group,the expression of LC3B Ⅱ/Ⅰ in PE placental tissues and hypoxia-induced trophoblast models was significantly upregulated,while the expression of p62 was significantly downregulated.Meanwhile,the ex-pression of FRMD4A increased significantly.Moreo-ver,its expression was positively correlated with the maternal systolic blood pressure,diastolic blood pres-sure,and platelet count,but negatively correlated with the neonatal weight(P＜0.01).In addition,hypoxia-induced trophoblast cells transfected with si-FRMD4A showed a significant decrease in LC3B Ⅱ/Ⅰ and an increase in p62 expression.Conclusions The expres-sion of FRMD4A is upregulated in PE placenta and hy-poxia-induced trophoblast cell model.Interfering with it can significantly hinder the autophagy process of trophoblast cells,suggesting that it may serve as a po-tential molecular target to participate in the pathologi-cal process of PE.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

Objective To investigate the effects of laparoscopic sleeve gastrectomy(LSG)on the cardiac structure and function in obese patients with heart failure(HF)and compare the efficacy of LSG across obese patients with different HF types.Methods This study included 33 obese patients with HF who underwent LSG.The clinical indicators were compared between before operation and 12 months after operation.Repeated measures analysis of variance was employed to evaluate the changes in echocardiographic parameters before operation and 3,6,and 12 months after operation.Patients were allocated into a HF with preserved ejection fraction group(n=17),a HF with mildly reduced ejection fraction group(n=5)and a HF with reduced ejection fraction(HFrEF)group(n=11)based on left ventricular ejection fraction(LVEF)before operation for subgroup analyses of the effects of LSG on the cardiac structure and function of obese patients with HF.The paired samples t-test was conducted to assess the degree of cardiac structural and functional alterations after LSG.Results The 33 patients included 69.7% males,with an average age of(35.3±9.9)years,and a body mass index(BMI)of(51.2±9.8)kg/m².The median follow-up was 9.0(5.0,13.3)months.Compared with the preoperative values,the postoperative BMI(P=0.002),body surface area(BSA)(P=0.009),waist circumference(P=0.010),hip circumference(P=0.031),body fat content(P=0.007),and percentage of patients with cardiac function grades Ⅲ-IV(P<0.001)decreased.At the 12-month follow-up left atrial diameter(P=0.006),right atrial long-axis inner diameter(RAD1)(P<0.001),right atrial short-axis inner diameter(RAD2)(P<0.001),right ventricular inner diameter(P=0.002),interventricular septal thickness at end-diastolic(P=0.002),and left ventricular end-diastolic volumes(P=0.004)and left ventricular end-systolic volumes(P=0.003) all significantly reduced compared with preoperative values.Additionally,left ventricular fractional shortening and LVEF improved(both P<0.001).Subgroup analyses revealed that cardiac structural parameters significantly decreased in the HF with preserved ejection fraction,HF with mildly reduced ejection fraction,and HFrEF subgroups compared with preoperative values.Notably,the HFrEF group demonstrated the best performance in terms of left atrial diameter(P=0.003),left ventricular inner diameter at end-diastole(P=0.008),RAD1(P<0.001),RAD2(P=0.004),right ventricular inner diameter(P=0.019),left ventricular end-diastolic volume(P=0.004)and left ventricular end-systolic volume(P=0.001),cardiac output(P=0.006),tricuspid regurgitation velocity(P=0.002),and pulmonary artery systolic pressure(P=0.001) compared to preoperatively.Postoperative left ventricular fractional shortening(P<0.001,P=0.003,P<0.001)and LVEF(P<0.001,P=0.011,P=0.001)became higher in all the three subgroups than the preoperative values.Conclusions LSG decreased the body weight,BMI,and BSA,improved the cardiac function grade,reversed the enlargement of the left atrium and left ventricle,reduced the right atrium and right ventricle,and enhanced the left ventricular systolic function.It was effective across obese patients with different HF types.Particularly,LSG demonstrates the best performance in improving the structures of both atria and ventricles in obese patients with HFrEF.
Humans ; Male ; Female ; Gastrectomy/methods* ; Heart Failure/complications* ; Adult ; Obesity/physiopathology* ; Laparoscopy ; Middle Aged ; Heart/physiopathology* ; Stroke Volume

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To construct a Z-score regression model for coronary artery diameter based on echocardiographic data from children in Sichuan Province and to establish a Z-score calculation formula. METHODS: A total of 744 healthy children who underwent physical examinations at Sichuan Provincial People's Hospital from January 2020 to December 2022 were selected as the modeling group, while 251 children diagnosed with Kawasaki disease at the same hospital from January 2018 to December 2022 were selected as the validation group. Pearson correlation analysis was conducted to analyze the relationships between coronary artery diameter values and age, height, weight, and body surface area. A regression model was constructed using function transformation to identify the optimal regression model and establish the Z-score calculation formula, which was then validated. RESULTS: The Pearson correlation analysis showed that the correlation coefficients for the diameters of the left main coronary artery, left anterior descending artery, left circumflex artery, and right coronary artery with body surface area were 0.815, 0.793, 0.704, and 0.802, respectively (P<0.05). Among the constructed regression models, the power function regression model demonstrated the best performance and was therefore chosen as the optimal model for establishing the Z-score calculation formula. Based on this Z-score calculation formula, the detection rate of coronary artery lesions was found to be 21.5% (54/251), which was higher than the detection rate based on absolute values of coronary artery diameter. Notably, in the left anterior descending and left circumflex arteries, the detection rate of coronary artery lesions using this Z-score calculation formula was higher than that of previous classic Z-score calculation formulas. CONCLUSIONS The Z-score calculation formula established based on the power function regression model has a higher detection rate for coronary artery lesions, providing a strong reference for clinicians, particularly in assessing coronary artery lesions in children with Kawasaki disease.
Humans ; Male ; Female ; Child, Preschool ; Child ; Coronary Artery Disease/diagnostic imaging* ; Infant ; Mucocutaneous Lymph Node Syndrome ; Regression Analysis ; Coronary Vessels/diagnostic imaging* ; Echocardiography ; Adolescent