1.Integrated evidence chain-based effectiveness evaluation of traditional Chinese medicines (Eff-iEC): A demonstration study.
Ye LUO ; Xu ZHAO ; Ruilin WANG ; Xiaoyan ZHAN ; Tianyi ZHANG ; Tingting HE ; Jing JING ; Jianyu LI ; Fengyi LI ; Ping ZHANG ; Junling CAO ; Jinfa TANG ; Zhijie MA ; Tingming SHEN ; Shuanglin QIN ; Ming YANG ; Jun ZHAO ; Zhaofang BAI ; Jiabo WANG ; Aiguo DAI ; Xiangmei CHEN ; Xiaohe XIAO
Acta Pharmaceutica Sinica B 2025;15(2):909-918
Addressing the enduring challenge of evaluating traditional Chinese medicines (TCMs), the integrated evidence chain-based effectiveness evaluation of TCMs (Eff-iEC) has emerged. This paper explored its capacity through a demonstration study that evaluated the effectiveness evidence of six commonly used anti-hepatic fibrosis Chinese patent medicines (CPMs), including Biejiajian Pill (BP), Dahuang Zhechong Pill (DZP), Biejia Ruangan Compound (BRC), Fuzheng Huayu Capsule (FHC), Anluo Huaxian Pill (AHP), and Heluo Shugan Capsule (HSC), using both Eff-iEC and the Grading of Recommendations, Assessment, Development, and Evaluation (GRADE) system. The recognition of these CPMs within the TCM academic community was also assessed through their inclusion in relevant medical documents. Results showed that the evidence of BRC and FHC received higher assessments in both Eff-iEC and GRADE system, while the assessments for others varied. Analysis of community recognition revealed that Eff-iEC more accurately reflects the clinical value of these CPMs, exhibiting superior evaluative capabilities. By breaking through the conventional pattern of TCMs effectiveness evaluation, Eff-iEC offers a novel epistemology that better aligns with the clinical realities and reasoning of TCMs, providing a coherent methodology for clinical decision-making, new drug evaluations, and health policy formulation.
2.An assessment model for efficacy of autologous CD19 chimeric antigen receptor T-cell therapy and relapse or refractory diffuse large B-cell lymphoma risk.
Bin XUE ; Yifan LIU ; Min ZHANG ; Gangfeng XIAO ; Xiu LUO ; Lili ZHOU ; Shiguang YE ; Yan LU ; Wenbin QIAN ; Li WANG ; Ping LI ; Aibin LIANG
Chinese Medical Journal 2025;138(1):108-110
3.Clinical trail of vericiguat combined with sacubitril valsartan sodium in the treatment of patients with heart failure with reduced ejection fraction
Miao-jun WANG ; Shi-ping XU ; Xiao-jin PAN ; Zhi-dong YE ; Yu-fang LIAN ; Jun QIU ; Shao-tang LU ; Sheng-jie ZHOU
The Chinese Journal of Clinical Pharmacology 2025;41(1):6-10
Objective To observe the clinical efficacy and safety of vericiguat tablets combined with sacubitril valsartan sodium(Sac/Val)tablets in the treatment of patients with heart failure with reduced ejection fraction(HFrEF).Methods The HFrEF patients were divided into control group and treatment group according to the cohort method.The control group was treated with Sac/Val tablets 200 mg per time,bid,orally.On the basis of control group,the treatment group was treated with vericiguat tablets 2.5 mg per time,qd,taken with meal.Two groups were treated for 3 months.The clinical efficacy,left ventricular ejection fraction(LVEF),left ventricular end-diastolic dimension(LVEDD)and end-systolic diameter(LVESD),levels of high sensitivity C-reactive protein(hs-CRP),interleukin-6(IL-6),nitric oxide(NO),N-terminal pro-brain natriuretic peptide(NT-proBNP),blood urea nitrogen(BUN)and serum creatinine(SCr),and safety were compared between the two groups.During follow-up,the heart failure rehospitalization rates and major adverse cardiovascular events were compared between the two groups.Results Treatment group was enrolled 53 patients,control group was enrolled 53 patients.After treatment,the total effective rates of treatment and control groups were 94.34%(50 cases/53 cases)and 81.13%(43 cases/53 cases)with statistical significant difference(P<0.05).After treatment,the LVEF of treatment and control groups were(48.02±5.20)%and(43.02±4.33)%,the LVEDDs were(52.85±6.30)and(55.63±6.88)mm,the LVESDs were(41.64±6.40)and(44.22±5.85)mm,the levels of hs-CRP were(10.22±2.63)and(14.60±2.98)mg L-1,the levels of IL-6 were(14.48±2.40)and(17.36±2.52)pg·mL-1,the levels of NO were(102.60±20.16)and(92.16±16.33)μmol·L-1,the levels of NT-proBNP were(898.74±102.20)and(1315.60±182.64)ng·L-1,the levels of BUN were(12.02±2.28)and(13.45±2.33)mmol·L-1,the levels of SCr were(82.22±5.89)and(85.64±6.03)μmol·L-1,the heart failure rehospitalization rates were 5.66%and 13.21%,respectively;the differences were statistical significant between two groups(all P<0.05).The adverse drug reactions of treatment group were hyperkalemia,hypotension,renal dysfunction,dizziness and headache,while those in control group were renal dysfunction,hyperkalemia,and hypotension.The major adverse cardiovascular events of treatment group were angina pectoris and acute myocardial infarction,while those in control group were angina pectoris,acute myocardial infarction and atrial fibrillation.The incidences of total adverse drug reactions in treatment and control groups were 13.21%and 7.55%,the incidences of major adverse cardiovascular events were 5.66%and 13.21%,respectively,without statistically significant differences(all P>0.05).Conclusion Vericiguat tablets combined with Sac/Val tablets have a definitive clinical efficacy in the treatment of HFrEF patients,which can improve cardiac and endothelial function,reduce inflammatory response and readmission times,without increasing the incidences of adverse drug reactions.
4.Isolation,identification,and biological characterization of enterotoxigenic Escherichia coli from a South China tiger
Jing-ru XU ; Zhi-hao ZHU ; Yu-qi LI ; Si-si FAN ; Ya-li KANG ; Yu-bin ZHUO ; Ling-shan HUANG ; Shu-qi QIU ; XUE-YUXI ; Xiao-ping WU ; Yu-ting LIAO ; Wei-ye LIN ; Xiao-ziyi XIAO ; Xue-jin LI ; Teng-teng CHEN ; Xi-pan LIN ; Kai-xiong LIN ; Ke-wei FAN
Chinese Journal of Zoonoses 2025;41(6):567-573
This study was aimed at identifying the pathogenic bacteria responsible for the death of a young tiger at the Fujian Meihua Mountain South China Tiger Breeding Research Institute.Tissue samples from the lungs,liver,and intestines of the deceased tiger were collected,and the bacteria were cultured inasterile environment.The bacterial strains were characterized according to their morphological and molecular biological properties,including assessment of virulence genes and antibiotic resistance genes,mouse lethality tests,and antibiotic susceptibility evaluations.A predominant bacterial strain isolated from the liver of the deceased tiger was identified as enterotoxigenic Escherichia coli(ETEC)strain Tiger22513F.Phylogenetic analysis of the 16S rRNA gene revealed that the Tiger22513F strain exhibited close genetic similarity to the reference strain ETEC(MF919609.1),with 99.9%nucleotide similarity,and resided on the same evolutionary branch.The Tiger22513F strain contained 11 antibiotic resistance genes(tetA,sul1,sul3,cmlA,floR,blaTEM,blaSHV,blaCMY-2,qnrA,qnrS,and qnrD)along with five virulence genes(VT1,fyuA,tsh,iucD,and ST).Mouse lethality tests indicated significant pathogenicity toward mice,affecting primarily the lungs,liver,and intestines.Antibiotic susceptibility testing demonstrated that this strain exhibited resistance to various classes of beta-lactam antibiotics,as well as quinolones and aminoglycosides.This investigation successfully isolated a multi-drug resistant enterotoxigenic Escherichia coli strain with pronounced pathogenicity from the liver of a deceased tiger;thus providing valuable scientific insights for clinical diagnosis,as well as prevention and control measures,against ETEC infections in South China tigers.
5.Guideline for Adult Weight Management in China
Weiqing WANG ; Qin WAN ; Jianhua MA ; Guang WANG ; Yufan WANG ; Guixia WANG ; Yongquan SHI ; Tingjun YE ; Xiaoguang SHI ; Jian KUANG ; Bo FENG ; Xiuyan FENG ; Guang NING ; Yiming MU ; Hongyu KUANG ; Xiaoping XING ; Chunli PIAO ; Xingbo CHENG ; Zhifeng CHENG ; Yufang BI ; Yan BI ; Wenshan LYU ; Dalong ZHU ; Cuiyan ZHU ; Wei ZHU ; Fei HUA ; Fei XIANG ; Shuang YAN ; Zilin SUN ; Yadong SUN ; Liqin SUN ; Luying SUN ; Li YAN ; Yanbing LI ; Hong LI ; Shu LI ; Ling LI ; Yiming LI ; Chenzhong LI ; Hua YANG ; Jinkui YANG ; Ling YANG ; Ying YANG ; Tao YANG ; Xiao YANG ; Xinhua XIAO ; Dan WU ; Jinsong KUANG ; Lanjie HE ; Wei GU ; Jie SHEN ; Yongfeng SONG ; Qiao ZHANG ; Hong ZHANG ; Yuwei ZHANG ; Junqing ZHANG ; Xianfeng ZHANG ; Miao ZHANG ; Yifei ZHANG ; Yingli LU ; Hong CHEN ; Li CHEN ; Bing CHEN ; Shihong CHEN ; Guiyan CHEN ; Haibing CHEN ; Lei CHEN ; Yanyan CHEN ; Genben CHEN ; Yikun ZHOU ; Xianghai ZHOU ; Qiang ZHOU ; Jiaqiang ZHOU ; Hongting ZHENG ; Zhongyan SHAN ; Jiajun ZHAO ; Dong ZHAO ; Ji HU ; Jiang HU ; Xinguo HOU ; Bimin SHI ; Tianpei HONG ; Mingxia YUAN ; Weibo XIA ; Xuejiang GU ; Yong XU ; Shuguang PANG ; Tianshu GAO ; Zuhua GAO ; Xiaohui GUO ; Hongyi CAO ; Mingfeng CAO ; Xiaopei CAO ; Jing MA ; Bin LU ; Zhen LIANG ; Jun LIANG ; Min LONG ; Yongde PENG ; Jin LU ; Hongyun LU ; Yan LU ; Chunping ZENG ; Binhong WEN ; Xueyong LOU ; Qingbo GUAN ; Lin LIAO ; Xin LIAO ; Ping XIONG ; Yaoming XUE
Chinese Journal of Endocrinology and Metabolism 2025;41(11):891-907
Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.
6.Development goals and strategies of ecological agriculture of Chinese materia medica.
Chuan-Zhi KANG ; Si-Qi LIU ; Bang-Xing HAN ; Tao ZHOU ; Xiao WANG ; Da-Hui LIU ; Ye YANG ; Lan-Ping GUO
China Journal of Chinese Materia Medica 2025;50(1):42-47
This paper aims to contribute to guaranteeing the stable development and enhancing the understanding of ecological agriculture of Chinese materia medica so that the national strategy and industrial demand can be better served. It first introduces current traditional Chinese medicine(TCM)policy and industrial development status from five aspects, including policy guarantee, theoretical support, technological innovation, standardization system, and brand influence. Then, the paper analyzes the development dilemma of TCM agriculture in production and quality increase and ecological environment protection. It also proposes the development goals of ecological agriculture of Chinese materia medica that meet the current industrial development demand, which are reducing chemical fertilizers, pesticides, and carbon emissions, improving quality, increasing efficiency, and protecting ecological environment. In addition, the new development goals are interpreted through case studies. Finally, this paper proposes four development strategies for ecological agriculture of Chinese materia medica: conducting research on the pattern and spatial and temporal variations of nationwide TCM production areas; studying the internal and external ecological memories of medicinal plant growth from the perspectives of genetic variations and environmental adaptation variations and elucidating their contributions to the formation of quality; carrying out selection and breeding of stress-resistant varieties for ecological agriculture of Chinese materia medica, the optimization of key technologies for soil improvement and restoration and green prevention and control against diseases and pests, and the improvement of quality; carrying out research on the quality assurance and value realization of ecological products made from TCM. This research can provide guidance for policy formulation, theoretical development of the discipline, and the enhancement of industrial technology for ecological agriculture of Chinese materia medica.
Agriculture/methods*
;
China
;
Drugs, Chinese Herbal
;
Plants, Medicinal/chemistry*
;
Ecosystem
;
Materia Medica
;
Medicine, Chinese Traditional
7.Expert consensus on evaluation index system construction for new traditional Chinese medicine(TCM) from TCM clinical practice in medical institutions.
Li LIU ; Lei ZHANG ; Wei-An YUAN ; Zhong-Qi YANG ; Jun-Hua ZHANG ; Bao-He WANG ; Si-Yuan HU ; Zu-Guang YE ; Ling HAN ; Yue-Hua ZHOU ; Zi-Feng YANG ; Rui GAO ; Ming YANG ; Ting WANG ; Jie-Lai XIA ; Shi-Shan YU ; Xiao-Hui FAN ; Hua HUA ; Jia HE ; Yin LU ; Zhong WANG ; Jin-Hui DOU ; Geng LI ; Yu DONG ; Hao YU ; Li-Ping QU ; Jian-Yuan TANG
China Journal of Chinese Materia Medica 2025;50(12):3474-3482
Medical institutions, with their clinical practice foundation and abundant human use experience data, have become important carriers for the inheritance and innovation of traditional Chinese medicine(TCM) and the "cradles" of the preparation of new TCM. To effectively promote the transformation of new TCM originating from the TCM clinical practice in medical institutions and establish an effective evaluation index system for the transformation of new TCM conforming to the characteristics of TCM, consensus experts adopted the literature research, questionnaire survey, Delphi method, etc. By focusing on the policy and technical evaluation of new TCM originating from the TCM clinical practice in medical institutions, a comprehensive evaluation from the dimensions of drug safety, efficacy, feasibility, and characteristic advantages was conducted, thus forming a comprehensive evaluation system with four primary indicators and 37 secondary indicators. The expert consensus reached aims to encourage medical institutions at all levels to continuously improve the high-quality research and development and transformation of new TCM originating from the TCM clinical practice in medical institutions and targeted at clinical needs, so as to provide a decision-making basis for the preparation, selection, cultivation, and transformation of new TCM for medical institutions, improve the development efficiency of new TCM, and precisely respond to the public medication needs.
Medicine, Chinese Traditional/standards*
;
Humans
;
Consensus
;
Drugs, Chinese Herbal/therapeutic use*
;
Surveys and Questionnaires
8.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
9.Diagnosis of coronary artery lesions in children based on Z-score regression model.
Yong WANG ; Jia-Ying JIANG ; Yan DENG ; Bo LI ; Ping SHUAI ; Xiao-Ping HU ; Yin-Yan ZHANG ; Han WU ; Lu-Wei YE ; Qian PENG
Chinese Journal of Contemporary Pediatrics 2025;27(2):176-183
OBJECTIVES:
To construct a Z-score regression model for coronary artery diameter based on echocardiographic data from children in Sichuan Province and to establish a Z-score calculation formula.
METHODS:
A total of 744 healthy children who underwent physical examinations at Sichuan Provincial People's Hospital from January 2020 to December 2022 were selected as the modeling group, while 251 children diagnosed with Kawasaki disease at the same hospital from January 2018 to December 2022 were selected as the validation group. Pearson correlation analysis was conducted to analyze the relationships between coronary artery diameter values and age, height, weight, and body surface area. A regression model was constructed using function transformation to identify the optimal regression model and establish the Z-score calculation formula, which was then validated.
RESULTS:
The Pearson correlation analysis showed that the correlation coefficients for the diameters of the left main coronary artery, left anterior descending artery, left circumflex artery, and right coronary artery with body surface area were 0.815, 0.793, 0.704, and 0.802, respectively (P<0.05). Among the constructed regression models, the power function regression model demonstrated the best performance and was therefore chosen as the optimal model for establishing the Z-score calculation formula. Based on this Z-score calculation formula, the detection rate of coronary artery lesions was found to be 21.5% (54/251), which was higher than the detection rate based on absolute values of coronary artery diameter. Notably, in the left anterior descending and left circumflex arteries, the detection rate of coronary artery lesions using this Z-score calculation formula was higher than that of previous classic Z-score calculation formulas.
CONCLUSIONS
The Z-score calculation formula established based on the power function regression model has a higher detection rate for coronary artery lesions, providing a strong reference for clinicians, particularly in assessing coronary artery lesions in children with Kawasaki disease.
Humans
;
Male
;
Female
;
Child, Preschool
;
Child
;
Coronary Artery Disease/diagnostic imaging*
;
Infant
;
Mucocutaneous Lymph Node Syndrome
;
Regression Analysis
;
Coronary Vessels/diagnostic imaging*
;
Echocardiography
;
Adolescent
10.Guideline for the prevention of intraoperative acquired pressure injury in paraplegic patients with spinal cord injury (version 2025)
Aijun XU ; Shuixia LI ; Bo CHEN ; Mengyuan YE ; Lejiao LANG ; Ning NING ; Lin ZHANG ; Changqing LIU ; Zhonglan CHEN ; Weihu MA ; Weishi LI ; Xiaoning WANG ; Dongmei BIAN ; Jiancheng ZENG ; Xin WANG ; Yuan GAO ; Yaping CHEN ; Jiali CHEN ; Yun HAN ; Xiuting LI ; Yang ZHOU ; Xiaojing SU ; Qiong ZHANG ; Tianwen HUANG ; Ping ZHANG ; Hua LIN ; Xingling XIAO ; Ruifeng XU ; Fanghui DONG ; Bing HAN ; Luo FAN ; Yanling PEI ; Suyun LI ; Xiaoju TAN ; Rongchen GUO ; Yefang ZOU ; Xiaoyun HAN ; Junqin DING ; Yi WANG ; Shuhua DENG ; Jinli GUO ; Yinhua LIANG ; Yuan CEN ; Xiaoqin LIU ; Junru CHEN ; Haiyang YU ; Lunlan LI ; Ying REN ; Yunxia LI ; Jianli LU ; Ying YING ; Lan WEI ; Yin WANG ; Qinhong XU ; Yanqin ZHANG ; Yang LYU ; Shijun ZHANG ; Sui WENJIE ; Sanlian HU ; Shuhong YANG ; Guoqing LI ; Jingjing AN ; Baorong HE ; Leling FENG
Chinese Journal of Trauma 2025;41(6):530-541
Paraplegia caused by spinal cord injury is a serious neurological complication, for which surgery is currently the main treatment method. Due to different surgical approaches, patients are usually expected to maintain a passive prone position for a long time or switch between the supine and prone positions. Affected by multiple factors such as neurogenic sensory disorders, pathological changes in muscle tone and operative duration, the risk of intraoperative acquired pressure injury (IAPI) is significantly increased. Current clinical prevention strategies for IAPI in these patients predominantly focus on localized pressure relief during positioning, lacking systematic, standardized comprehensive prevention protocols or evidence-based guidelines. To address it, Department of Nursing, Orthopedics Branch, China International Exchange and Promotive Association for Medical and Health Care, Spinal Trauma Professional Committee, Orthopedics Branch, Chinese Medical Doctor Association, Nursing Group of Spine and Spinal Cord Professional Committee of Chinese Association of Rehabilitation Medicine organized experts in relevant fields to formulate Guideline for the prevention of intraoperative acquired pressure injury in paraplegic patients with spinal cord injury ( version 2025), based on evidence-based medical evidence and latest research results and clinical practice at home and abroad. Eleven recommendations were put forward from the aspects of preoperative risk assessment, intraoperative prevention strategies, postoperative handover and monitoring, and supportive mechanisms for IAPI prevention, aiming to standardize the prevention measures and management strategies of IAPI in paraplegic patients with spinal cord injury and accelerate the recovery of patients and improve the therapeutic effect.

Result Analysis
Print
Save
E-mail