1.Inheritance, excavation, and modern research overview of processing methods of traditional Chinese medicine decoctions.
Xiao-Xia LIU ; Ping LUO ; Ling-Yun ZHONG ; Fang WANG ; Ming YANG
China Journal of Chinese Materia Medica 2025;50(13):3596-3631
"Prescriptions being modified according to the syndrome and processing following prescription" is one of the characteristics of clinical medication in traditional Chinese medicine(TCM), and it is also an important sign that distinguishes TCM from other traditional medicine. The processing methods of TCM decoctions originate from the ingenious combination of medicinal materials, the mutual restraint of seven emotions, the harmony of four properties, and the pairing and combining of medicinal materials in prescriptions. They are the concrete embodiment of the essence and characteristics of "prescriptions being modified according to the syndrome and processing following prescription". However, due to insufficient inheritance and innovation, many characteristic varieties and pharmaceutical experience have been lost or forgotten. There is an urgent need to systematically explore and organize the processing theory and characteristic varieties of TCM decoctions, delve into the scientific connotation of the processing principles, and optimize the processing technology. Therefore, this article systematically organizes and summarizes the historical evolution and modern research progress of TCM decoction processing, conducts in-depth reflection on the current problems, and puts forward reasonable suggestions, with the aim of further inheriting, enriching, and developing the processing theory of TCM decoctions and providing support for ensuring the clinical efficacy of prescriptions.
Drugs, Chinese Herbal/isolation & purification*
;
Humans
;
Medicine, Chinese Traditional/methods*
2.Intramedullary administration of tranexamic acid reduces bleeding in proximal femoral nail antirotation surgery for intertrochanteric fractures in elderly individuals: A randomized controlled trial.
Xiang-Ping LUO ; Jian PENG ; Ling ZHOU ; Hao LIAO ; Xiao-Chun JIANG ; Xiong TANG ; Dun TANG ; Chao LIU ; Jian-Hui LIU
Chinese Journal of Traumatology 2025;28(3):201-207
PURPOSE:
Intertrochanteric fractures undergoing proximal femoral nail antirotation (PFNA) surgery are associated with significant hidden blood loss. This study aimed to explore whether intramedullary administration of tranexamic acid (TXA) can reduce bleeding in PFNA surgery for intertrochanteric fractures in elderly individuals.
METHODS:
A randomized controlled trial was conducted from January 2019 to December 2022. Patients aged over 60 years with intertrochanteric fractures who underwent intramedullary fixation surgery with PFNA were eligible for inclusion and grouped according to random numbers. A total of 249 patients were initially enrolled, of which 83 were randomly allocated to the TXA group and 82 were allocated to the saline group. The TXA group received intramedullary perfusion of TXA after the bone marrow was reamed. The primary outcomes were total peri-operative blood loss and post-operative transfusion rate. The occurrence of adverse events was also recorded. Continuous data was analyzed by unpaired t-test or Mann-Whitney U test, and categorical data was analyzed by Pearson Chi-square test.
RESULTS:
The total peri-operative blood loss (mL) in the TXA group was significantly lower than that in the saline group (577.23 ± 358.02 vs. 716.89 ± 420.30, p = 0.031). The post-operative transfusion rate was 30.67% in the TXA group and 47.95% in the saline group (p = 0.031). The extent of post-operative deep venous thrombosis and the 3-month mortality rate were similar between the 2 groups.
CONCLUSION
We observed that intramedullary administration of TXA in PFNA surgery for intertrochanteric fractures in elderly individuals resulted in less peri-operative blood loss and decreased transfusion rate, without any adverse effects, and is, thus, recommended.
Humans
;
Tranexamic Acid/administration & dosage*
;
Hip Fractures/surgery*
;
Male
;
Aged
;
Female
;
Fracture Fixation, Intramedullary/adverse effects*
;
Blood Loss, Surgical/prevention & control*
;
Antifibrinolytic Agents/administration & dosage*
;
Aged, 80 and over
;
Bone Nails
;
Middle Aged
;
Blood Transfusion/statistics & numerical data*
3.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
4.Oxymatrine, a novel TLR2 agonist, promotes megakaryopoiesis and thrombopoiesis through the STING/NF-κB pathway.
Chengyang NI ; Ling ZHOU ; Shuo YANG ; Mei RAN ; Jiesi LUO ; Kui CHENG ; Feihong HUANG ; Xiaoqin TANG ; Xiang XIE ; Dalian QIN ; Qibing MEI ; Long WANG ; Juan XIAO ; Jianming WU
Journal of Pharmaceutical Analysis 2025;15(1):101054-101054
Radiation-induced thrombocytopenia (RIT) faces a perplexing challenge in the clinical treatment of cancer patients, and current therapeutic approaches are inadequate in the clinical settings. In this research, oxymatrine, a new molecule capable of healing RIT was screened out, and the underlying regulatory mechanism associated with magakaryocyte (MK) differentiation and thrombopoiesis was demonstrated. The capacity of oxymatrine to induce MK differentiation was verified in K-562 and Meg-01 cells in vitro. The ability to induce thrombopoiesis was subsequently demonstrated in Tg (cd41:enhanced green fluorescent protein (eGFP)) zebrafish and RIT model mice. In addition, we carried out network pharmacological prediction, drug affinity responsive target stability assay (DARTS) and cellular thermal shift assay (CETSA) analyses to explore the potential targets of oxymatrine. Moreover, the pathway underlying the effects of oxymatrine was determined by Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses, Western blot (WB), and immunofluorescence. Oxymatrine markedly promoted MK differentiation and maturation in vitro. Moreover, oxymatrine induced thrombopoiesis in Tg (cd41:eGFP) zebrafish and accelerated thrombopoiesis and platelet function recovery in RIT model mice. Mechanistically, oxymatrine directly binds to toll-like receptor 2 (TLR2) and further regulates the downstream pathway stimulator of interferon genes (STING)/nuclear factor-kappaB (NF-κB), which can be blocked by C29 and C-176, which are specific inhibitors of TLR2 and STING, respectively. Taken together, we demonstrated that oxymatrine, a novel TLR2 agonist, plays a critical role in accelerating MK differentiation and thrombopoiesis via the STING/NF-κB axis, suggesting that oxymatrine is a promising candidate for RIT therapy.
5.Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey.
Xiao-Chao LUO ; Jia-Li LIU ; Ming-Hong YAO ; Ye-Meng CHEN ; Arthur Yin FAN ; Fan-Rong LIANG ; Ji-Ping ZHAO ; Ling ZHAO ; Xu ZHOU ; Xiao-Ying ZHONG ; Jia-Hui YANG ; Bo LI ; Ying ZHANG ; Xin SUN ; Ling LI
Journal of Integrative Medicine 2025;23(6):630-640
BACKGROUND:
The use of inserted sham acupuncture as a placebo in randomized controlled trials (RCTs) is controversial, because it may produce specific effects that cause an underestimation of the effect of acupuncture treatment.
OBJECTIVE:
This systematic survey investigates the magnitude of insert-specific effects of sham acupuncture and whether they affect the estimation of acupuncture treatment effects.
SEARCH STRATEGY:
PubMed, Embase and Cochrane Central Register of Controlled Trials were searched to identify acupuncture RCTs from their inception until December 2022.
INCLUSION CRITERIA:
RCTs that evaluated the effects of acupuncture compared to sham acupuncture and no treatment.
DATA EXTRACTION AND ANALYSIS:
The total effect measured for an acupuncture treatment group in RCTs were divided into three components, including the natural history and/or regression to the mean effect (controlled for no-treatment group), the placebo effect, and the specific effect of acupuncture. The first two constituted the contextual effect of acupuncture, which is mimicked by a sham acupuncture treatment group. The proportion of acupuncture total effect size was considered to be 1. The proportion of natural history and/or regression to the mean effect (PNE) and proportional contextual effect (PCE) of included RCTs were pooled using meta-analyses with a random-effect model. The proportion of acupuncture placebo effect was the difference between PCE and PNE in RCTs with non-inserted sham acupuncture. The proportion of insert-specific effect of sham acupuncture (PIES) was obtained by subtracting the proportion of acupuncture placebo effect and PNE from PCE in RCTs with inserted sham acupuncture. The impact of PIES on the estimation of acupuncture's treatment effect was evaluated by quantifying the percentage of RCTs that the effect of outcome changed from no statistical difference to statistical difference after removing PIES in the included studies, and the impact of PIES was externally validated in other acupuncture RCTs with an inserted sham acupuncture group that were not used to calculate PIES.
RESULTS:
This analysis included 32 studies with 5492 patients. The overall PNE was 0.335 (95% confidence interval [CI], 0.255-0.415) and the PCE of acupuncture was 0.639 (95% CI, 0.567-0.710) of acupuncture's total effect. The proportional contribution of the placebo effect to acupuncture's total effect was 0.191, and the PIES was 0.189. When we modeled the exclusion of the insert-specific effect of sham acupuncture, the acupuncture treatment effect changed from no difference to a significant difference in 45.45% of the included RCTs, and in 40.91% of the external validated RCTs.
CONCLUSION
The insert-specific effect of sham acupuncture in RCTs represents 18.90% of acupuncture's total effect and significantly affects the evaluation of the acupuncture treatment effect. More than 40% of RCTs that used inserted sham acupuncture would draw different conclusions if the PIES had been controlled for. Considering the impact of the insert-specific effect of sham acupuncture, caution should be taken when using inserted sham acupuncture placebos in RCTs. Please cite this article as: Luo XC, Liu JL, Yao MH, Chen YM, Fan AY, Liang FR, Zhao JP, Zhao L, Zhou X, Zhong XY, Yang JH, Li B, Zhang Y, Sun X, Li L. Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey. J Integr Med. 2025; 23(6):630-640.
Acupuncture Therapy/methods*
;
Humans
;
Randomized Controlled Trials as Topic
;
Placebo Effect
;
Placebos
;
Treatment Outcome
6.Effects of traditional Chinese medicine on treatment outcomes in severe COVID-19 patients: a single-centre study.
Yongjiu XIAO ; Binbin LI ; Chang LIU ; Xiuyu HUANG ; Ling MA ; Zhirong QIAN ; Xiaopeng ZHANG ; Qian ZHANG ; Dunqing LI ; Xiaoqing CAI ; Xiangyong YAN ; Shuping LUO ; Dawei XIANG ; Kun XIAO
Chinese Journal of Natural Medicines (English Ed.) 2024;22(1):89-96
As the search for effective treatments for COVID-19 continues, the high mortality rate among critically ill patients in Intensive Care Units (ICU) presents a profound challenge. This study explores the potential benefits of traditional Chinese medicine (TCM) as a supplementary treatment for severe COVID-19. A total of 110 critically ill COVID-19 patients at the Intensive Care Unit (ICU) of Vulcan Hill Hospital between Feb., 2020, and April, 2020 (Wuhan, China) participated in this observational study. All patients received standard supportive care protocols, with a subset of 81 also receiving TCM as an adjunct treatment. Clinical characteristics during the treatment period and the clinical outcome of each patient were closely monitored and analysed. Our findings indicated that the TCM group exhibited a significantly lower mortality rate compared with the non-TCM group (16 of 81 vs 24 of 29; 0.3 vs 2.3 person/month). In the adjusted Cox proportional hazards models, TCM treatment was associated with improved survival odds (P < 0.001). Furthermore, the analysis also revealed that TCM treatment could partially mitigate inflammatory responses, as evidenced by the reduced levels of proinflammatory cytokines, and contribute to the recovery of multiple organic functions, thereby potentially increasing the survival rate of critically ill COVID-19 patients.
Humans
;
COVID-19
;
Medicine, Chinese Traditional
;
SARS-CoV-2
;
Critical Illness
;
Treatment Outcome
7.Study on Down-regulation of Interleukin-1β Secretion by Inhibiting ABCC1/MRP1 Transporter
Yuan-Yuan CHEN ; Pei-Ting YING ; Wen-Wen WENG ; Mei-Xin FANG ; Jiang LI ; Ze-Bin LUO ; Ming JIA ; Xiao-Ping GUO ; Ling-Yan ZHANG ; Xiao-Jun XU ; Yong-Min TANG
Journal of Experimental Hematology 2024;32(3):911-919
Objective:To screen interleukin(IL)-1β secretion-related membrane transporters by macrophage experiment in vitro and conventional knockout mice.Methods:THP-1 cell line was differentiated to obtain human THP-1-derived macrophages,and the primary macrophages were obtained from human peripheral blood.FVB wild-type mice with the same sex and age were used as the controls of MRP1 knockout mice.The macrophages in abdominal cavity and bone marrow of mice were cultivated.The cells were treated with ABCC1/MRP1,ABCG2/BCRP,ABCB1/P-gp,OATP1B1,and MATE transporter inhibitors,then stimulated by lipopolysaccharide and adenosine triphosphate.The secretion level of IL-iβ was detected by ELISA,Western blot,and immunofluorescence.Results:After inhibiting ABCC1/MRP1 transporter,the secretion of IL-1β decreased significantly,while inhibition of the other 4 transporters had no effect.In animal experiment,the level of IL-1 β secreted by macrophages in bone marrow of MRP1 knockout mice was significantly lower than control group(P<0.05).Conclusion:ABCC1/MRP1 transporter is a newly discovered IL-1β secretion pathway,which is expected to become a new target for solving clinical problems such as cytokine release syndrome.
8.Study on the Treatment of Dampness Stagnated in the Triple Energizer Based on the Theory of"Qi Transformation Leading to the Removal of Pathogenic Dampness"
Xiao-Ying MO ; Wei-Jun RUAN ; Feng-Ling ZHENG ; Huan-Huan LUO
Journal of Guangzhou University of Traditional Chinese Medicine 2024;41(4):1048-1052
The statement of"qi transformation leading to the removal of pathogenic dampness"was recorded in Wen Bing Tiao Bian(Analysis on Epidemic Febrile Diseases)written by the Qing Dynasty physician WU Ju-Tong.Dampness in the triple energizer is caused by the dysfunction of qi transformation,and the treatment of dampness must be based on the activation of qi movement and focused on the promotion of qi movement and the restoration of the qi transformation in the triple energizer.For the treatment of dampness attack in the upper energizer,therapies of dispersing lung to smooth qi and resolving dampness to relieve the obstruction are recommended.For the treatment of dampness obstruction in the middle energizer,therapy of activating spleen qi by strengthening spleen and moving qi is stressed for helping the removal of dampness and for the eradication of the source of dampness.For the treatment of dampness stagnation in the lower energizer,therapy of draining dampness with sweet-light medicines and activating yang can be used according to the illness status.The three methods of treating dampness,namely dispersing the upper energizer,activating the middle energizer and draining the lower energizer,all embody the mechanism of"qi transformation leading to the removal of pathogenic dampness",and the therapies of dispersing lung with light medicines,inducing perspiration by opening striated layer,eliminating dampness with aromatics and draining dampness with sweet-light medicines should be used in accordance with the syndromes.The elucidation of the academic thoughts of"qi transformation leading to the removal of pathogenic dampness"can provide theoretical reference for the fundamental research of dampness syndrome and clinical application of therapies for resolving dampness in Chinese medicine.
9.Latent tuberculosis infection among close contacts of positive etiology pul-monary tuberculosis in Chongqing
Rong-Rong LEI ; Hong-Xia LONG ; Cui-Hong LUO ; Ben-Ju YI ; Xiao-Ling ZHU ; Qing-Ya WANG ; Ting ZHANG ; Cheng-Guo WU ; Ji-Yuan ZHONG
Chinese Journal of Infection Control 2024;23(3):265-270
Objective To investigate the current situation and influencing factors of latent tuberculosis infection(LTBI)among close contacts of positive etiology pulmonary tuberculosis(PTB)patients,provide basis for formula-ting intervention measures for LTBI.Methods A multi-stage stratified cluster random sampling method was used to select close contacts of positive etiology PTB patients from 39 districts and counties in Chongqing City as the study objects.Demographic information was collected by questionnaire survey and the infection of Mycobacterium tuberculosis was detected by interferon gamma release assay(IGRA).The influencing factors of LTBI were analyzed by x2 test and binary logistic regression model.Results A total of 2 591 close contacts were included,the male to female ratio was 0.69∶1,with the mean age of(35.72±16.64)years.1 058 cases of LTBI were detected,Myco-bacterium tuberculosis latent infection rate was 40.83%.Univariate analysis showed that the infection rate was dif-ferent among peoples of different age,body mass index(BMI),occupation,education level,marital status,wheth-er they had chronic disease or major surgery history,whether they lived together with the indicator case,and whether the cumulative contact time with the indicator case ≥250 hours,difference were all statistically significant(all P<0.05);infection rate presented increased trend with the increase of age and BMI(both P<0.001),and decreased trend with the increase of education(P<0.05).Logistic regression analysis showed that age 45-54 years old(OR=1.951,95%CI:1.031-3.693),age 55-64 years old(OR=2.473,95%CI:1.279-4.781),other occupations(OR=0.530,95%CI:0.292-0.964),teachers(OR=0.439,95%CI:0.242-0.794),students(OR=0.445,95%CI:0.233-0.851),junior high school education or below(OR=1.412,95%CI:1.025-1.944),BMI<18.5 kg/m2(OR=0.762,95%CI:0.586-0.991),co-living with indicator cases(OR=1.621,95%CI1.316-1.997)and cumu-lative contact time with indicator cases ≥250 hours(OR=1.292,95%CI:1.083-1.540)were the influential fac-tors for LTBI(all P<0.05).Conclusion The close contacts with positive etiology PTB have a high latent infection rate of Mycobacterium tuberculosis,and it is necessary to pay attention to close contacts of high age,farmers,and frequent contact with patients,and take timely targeted interventions to reduce the risk of occurrence of disease.
10.Investigation and control of a suspected outbreak of carbapenem-resistant Klebsiella pneumoniae bloodstream infection in patients with hematologi-cal tumors
Ni ZENG ; Guang-Ying LUO ; Jing-Jing LI ; Qing-Qing WANG ; Xiao-Li ZHOU ; Ling-Zhu LI ; Zhu-Hong ZHA
Chinese Journal of Infection Control 2024;23(3):316-322
Objective To investigate a suspected outbreak of carbapenem-resistant Klebsiella pneumoniae(CRKP)healthcare-associated bloodstream infection(HA-BSI),provide reference for effective control of CRKP in-fection.Methods The characteristics of CRKP infected patients and the risk factors for the event transmission in an adult hematology department of a teaching hospital in June 2022 were obtained by field epidemiological investigation.The specimens of environmental target strains were co-llected by blood nutrient agar inoculation,the removal status of environmental microorganisms and the effect of infection control after implementing control measures were com-pared.Results There were a total of 6 cases of CRKP HA-BSI,with an attacking rate of 1.29%(6/464),which was significantly higher than 0 during the same period in 2021,and difference was statistically significant(P=0.011).In environmental hygiene monitoring,the detection rate of CRKP was 2.27%(1/44),which was from the surface of bed curtain in the living unit of infected patients,homology analysis with CRKP detected from 2 patients revealed that the 16s RNA of 3 CRKP strains was completely identical,with a similarity of 100%.Seven house-keeping genes of 3 CRKP strains were all identical and belonged to the ST11 type.Comprehensive control measures were taken:appropriate closure of the ward,centralized isolation of patients,terminal disinfection of the ward,reg-ular health care workers and relative restriction of their activity areas.After the measures were taken,the qualified rate of microbial colony count in the ward increased compared to before taking the measures(2.27%vs 68.89%,P<0.001),with a statistically significant difference,there were no more CRKP infected cases after the intervention,indicating that the control measures were effective.Conclusion This outbreak was caused by ST11 type of common CRKP in China,and laminar bed curtains are carriers of pathogen transmission.It is speculated that non-standard cleaning and disinfection,as well as inadequate implementation of hand hygiene are the main causes for transmis-sion.Adopting an appropriate strategy of closing the ward and concentrating patient isolation can quickly and effec-tively prevent the transmission of the event.

Result Analysis
Print
Save
E-mail