Nanoparticle delivery systems have good application prospects in the field of precision therapy, but the preparation process of nanomaterial has problems such as short in vivo circulation time, easy recognition, and clearance by the immune system in the body. In recent years, biomimetic nanoparticle delivery systems mediated by natural cell membranes have become a research hotspot to address these issues. The natural membrane biomimetic nanoparticle delivery system cleverly integrates the advantages of natural biofilm "autologous" and "artificial" functional carriers by using endogenous cell membranes to modify the surface of nanocarriers, endowing them with characteristics such as tumor targeting, low immunogenicity, and long blood circulation. Currently, biomimetic nanoparticle delivery systems have been used in the treatment of malignant tumors, cardiovascular diseases, bacterial infections, and other diseases. This paper analyzes the development status and current research hotspots of natural cell membrane camouflaged biomimetic nanoparticle delivery systems mainly reviews the latest research progress of red blood cell membrane camouflaged biomimetic nanoparticle delivery systems in the field of disease treatment in recent years. It focuses on exploring the advantages, future development prospects, and limitations of biomimetic nanoparticle delivery systems based on red blood cell membrane camouflage in improving drug delivery, to provide a reference for the in-depth research and development of this system.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To explore the clinical significance of circulating tumor DNA (ctDNA) in response evaluation and relapse monitoring for patients with primary mediastinal large B-cell lymphoma (PMBCL). METHODS: The clinical characteristics, efficacy and survival of 38 PMBCL patients in our hospital from January 2010 to April 2020 were retrospectively analyzed. The ctDNA monitoring was conducted by targeted next-generation sequencing (NGS). RESULTS: Among the 38 patients, 26 cases were female, and 32 cases were diagnosed with Ann Arbor stage I-II. The 5-year overall survival (OS) rate and progression-free survival (PFS) rate were 74.7% and 61.7%, respectively. Males and those with high aaIPI scores (3 points) had a relatively poor prognosis. The NGS results of 23 patients showed that STAT6 (65.2%), SOCS1 (56.5%), and TNFAIP3 (56.5%) were the most common mutated genes. Patients with stable disease (SD)/progressive disease (PD) exhibited enrichment in cell cycle, FoxO, and TNF signaling pathways. A total of 29 patients underwent end-of-treatment PET/CT (EOT PET/CT), and 16 of them received ctDNA monitoring with 12 negative. Among 6 patients with EOT PET/CT positive (Deauville 4), 4 underwent ctDNA monitoring, and 3 of them were negative, being still in continuous remission without any subsequent anti-tumor therapy. CONCLUSION CtDNA may be combined with PET/CT to assess efficacy, monitor relapse, and guide treatment of PMBCL.
Humans ; Circulating Tumor DNA/blood* ; Female ; Mediastinal Neoplasms ; Male ; Retrospective Studies ; High-Throughput Nucleotide Sequencing ; Prognosis ; Lymphoma, Large B-Cell, Diffuse/genetics* ; Middle Aged ; Adult ; Aged ; Neoplasm Recurrence, Local ; Mutation

[This corrects the article DOI: 10.11909/j.issn.1671-5411.2017.08.005.].

OBJECTIVE: To investigate the effectiveness of Xuanshen Yishen Decoction (XYD) in the treatment of hypertension. METHODS: Hospital electronic medical records from 2019-2023 were utilized to emulate a randomized pragmatic clinical trial. Hypertensive participants were eligible if they were aged ⩾40 years with baseline systolic blood pressure (BP) ⩾140 mm Hg. Patients treated with XYD plus antihypertensive regimen were assigned to the treatment group, whereas those who followed only antihypertensive regimen were assigned to the control group. The primary outcome assessed was the attainment rate of intensive BP control at discharge, with the secondary outcome focusing on the 6-month all-cause readmission rate. RESULTS: The study included 3,302 patients, comprising 2,943 individuals in the control group and 359 in the treatment group. Compared with the control group, a higher proportion in the treatment group achieved the target BP for intensive BP control [8.09% vs. 17.5%; odds ratio (OR)=2.29, 95% confidence interval (CI)=1.68 to 3.13; P<0.001], particularly in individuals with high homocysteine levels (OR=3.13; 95% CI=1.72 to 5.71; P<0.001; P for interaction=0.041). Furthermore, the 6-month all-cause readmission rate in the treatment group was lower than in the control group (hazard ratio=0.58; 95% CI=0.36 to 0.91; P=0.019), and the robustness of the results was confirmed by sensitivity analyse. CONCLUSIONS XYD could be a complementary therapy for intensive BP control. Our study offers real-world evidence and guides the choice of complementary and alternative therapies. (Registration No. ChiCTR2400086589).
Adult ; Aged ; Female ; Humans ; Male ; Middle Aged ; Antihypertensive Agents/pharmacology* ; Blood Pressure/drug effects* ; Drugs, Chinese Herbal/pharmacology* ; Hypertension/physiopathology* ; Patient Readmission ; Treatment Outcome

Ischemic stroke (IS) is a globally life-threatening disease. Presently, few therapeutic medicines are available for treating IS, and rt-PA is the only drug approved by the US Food and Drug Administration (FDA) in the US. In fact, many agents showing excellent neuroprotection but no blood flow-improving activity in animals have not achieved ideal clinical efficacy, while thrombolytic drugs only improving blood flow without neuroprotection have limited their wider application. To address these challenges and meet the huge unmet clinical need, we have designed and identified a novel compound AAPB with dual effects of neuroprotection and cerebral blood flow improvement. AAPB significantly reduced cerebral infarction and neural function deficit in tMCAO rats, pMCAO rats, and IS rhesus monkeys, as well as displayed exceptional safety profiles and excellent pharmacokinetic properties in rats and dogs. AAPB has now entered phase I of clinical trials fighting IS in China.

BACKGROUND: The use of inserted sham acupuncture as a placebo in randomized controlled trials (RCTs) is controversial, because it may produce specific effects that cause an underestimation of the effect of acupuncture treatment. OBJECTIVE: This systematic survey investigates the magnitude of insert-specific effects of sham acupuncture and whether they affect the estimation of acupuncture treatment effects. SEARCH STRATEGY: PubMed, Embase and Cochrane Central Register of Controlled Trials were searched to identify acupuncture RCTs from their inception until December 2022. INCLUSION CRITERIA: RCTs that evaluated the effects of acupuncture compared to sham acupuncture and no treatment. DATA EXTRACTION AND ANALYSIS: The total effect measured for an acupuncture treatment group in RCTs were divided into three components, including the natural history and/or regression to the mean effect (controlled for no-treatment group), the placebo effect, and the specific effect of acupuncture. The first two constituted the contextual effect of acupuncture, which is mimicked by a sham acupuncture treatment group. The proportion of acupuncture total effect size was considered to be 1. The proportion of natural history and/or regression to the mean effect (PNE) and proportional contextual effect (PCE) of included RCTs were pooled using meta-analyses with a random-effect model. The proportion of acupuncture placebo effect was the difference between PCE and PNE in RCTs with non-inserted sham acupuncture. The proportion of insert-specific effect of sham acupuncture (PIES) was obtained by subtracting the proportion of acupuncture placebo effect and PNE from PCE in RCTs with inserted sham acupuncture. The impact of PIES on the estimation of acupuncture's treatment effect was evaluated by quantifying the percentage of RCTs that the effect of outcome changed from no statistical difference to statistical difference after removing PIES in the included studies, and the impact of PIES was externally validated in other acupuncture RCTs with an inserted sham acupuncture group that were not used to calculate PIES. RESULTS: This analysis included 32 studies with 5492 patients. The overall PNE was 0.335 (95% confidence interval [CI], 0.255-0.415) and the PCE of acupuncture was 0.639 (95% CI, 0.567-0.710) of acupuncture's total effect. The proportional contribution of the placebo effect to acupuncture's total effect was 0.191, and the PIES was 0.189. When we modeled the exclusion of the insert-specific effect of sham acupuncture, the acupuncture treatment effect changed from no difference to a significant difference in 45.45% of the included RCTs, and in 40.91% of the external validated RCTs. CONCLUSION The insert-specific effect of sham acupuncture in RCTs represents 18.90% of acupuncture's total effect and significantly affects the evaluation of the acupuncture treatment effect. More than 40% of RCTs that used inserted sham acupuncture would draw different conclusions if the PIES had been controlled for. Considering the impact of the insert-specific effect of sham acupuncture, caution should be taken when using inserted sham acupuncture placebos in RCTs. Please cite this article as: Luo XC, Liu JL, Yao MH, Chen YM, Fan AY, Liang FR, Zhao JP, Zhao L, Zhou X, Zhong XY, Yang JH, Li B, Zhang Y, Sun X, Li L. Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey. J Integr Med. 2025; 23(6):630-640.
Acupuncture Therapy/methods* ; Humans ; Randomized Controlled Trials as Topic ; Placebo Effect ; Placebos ; Treatment Outcome

Objective To investigate the correlation between traditional Chinese medicine(TCM)syndrome elements and risk factors in children with IgA vasculitis(IgAV,also known as Henoch-Sch?nlein purpura).Methods The medical records of 131 children with IgAV were retrospectively analyzed.And then the distribution of their TCM syndrome elements was investigated,and the correlation of TCM syndrome elements with the gender,age,clinical symptoms,as well as risk factors such as mosquito bite,pathogen infection,and allergic rhinitis was analyzed.Results(1)Among the 131 children with IgAV,the diseases-location syndrome elements of IgAV involved lung in 97 cases(74.05%),spleen in 61 cases(46.56%),kidney in 54 cases(41.22%),liver in 17 cases(12.98%),and heart in 11 cases(8.40%);the disease-nature syndrome elements of IgAV involved blood stasis in 131 cases(100.00%),wind-damp in 125 cases(95.42%),wind-heat in 90 cases(68.70%),damp-heat in 72 cases(54.96%),blood heat in 49 cases(37.40%),qi deficiency in 19 cases(14.50%),and yin deficiency in three cases(2.29%).(2)There were 69 cases(52.67%)of females and 62 cases(47.33%)of males among the IgAV children,with females outnumbering males.The age group of IgAV children was predominated by five to six years old,and 10 cases(7.63%)were younger than four years old,18 cases(13.74%)were four years old,39 cases(29.77%)were five years old,34 cases(25.95%)were six years old,17 cases(12.98%)were seven years old,and 13 cases(9.92%)were older than seven years old.The disease-nature syndrome elements such as blood stasis,wind-damp,wind-heat,and damp-heat were frequently seen in the age group of five to seven years old,yin deficiency was frequently seen in the age group older than seven years,and blood stasis was seen in all age groups.(3)The results of logistic regression analysis of the correlation between TCM syndrome elements and risk factors in IgAV patients showed that allergic rhinitis was positively correlated with blood stasis[OR=2.236,95%CI(1.049-4.007)],damp-heat[OR=2.183,95%CI(1.554-3.671)]and wind-damp[OR=1.202,95%CI(1.050-2.409)];pathogen infection was positively correlated with blood stasis[OR=3.199,95%CI(1.457-4.101)]and damp-heat[OR=1.119,95%CI(1.072-2.009)];mosquito bite was positively correlated with blood stasis[OR=4.533,95%CI(1.029-9.022)]and damp-heat[OR=2.257,95%CI(1.081-13.207)];the gender was positively correlated with blood stasis[OR=1.352,95%CI(1.271-3.018)]and wind-damp[OR=1.149,95%CI(1.071-3.102)].The differences were all statistically significant(P＜0.05 or P＜0.01).Conclusion IgAV usually involves the lungs and is also related to the five zang organs.Its pathogenesis is characterized by excess in superficiality such as blood stasis and wind-damp-heat in the early stage,and is predominated by deficiency in origin such as qi deficiency and yin deficiency in the later stage.For the children with IgAV,mosquito bite,pathogen infection and allergic rhinitis are more likely to induce blood stasis and wind-damp-heat;TCM syndrome elements such as wind-heat,damp-heat,blood heat,and qi deficiency are frequently seen in the males,while TCM syndrome elements such as blood stasis,wind-damp,and yin deficiency are frequently seen in the females.

Objective:To compare the efficacy and clinical value of high-throughput sequencing(HTS)and Sanger sequencing in detecting ABL kinase domain mutations in patients with chronic myeloid leukemia(CML).Methods:A total of 198 samples of 147 CML patients from July 2017 to March 2021 in Henan Cancer Hospital were collected and underwent high-throughput sequencing and Sanger sequencing to detect the mutations in ABL kinase domain,and the relevant clinical data were collected for comparative analysis.Results:The proportion of total mutations and ≥ 2 mutations detected by high-throughput sequencing were significantly higher than those detected by Sanger sequencing(P=0.01;P=0.046).≥ 2 mutations were detected in 22 cases,of which 5 cases(22.7％)had compound mutations.High-throughput sequencing can detect low level mutations that cannot be detected by Sanger sequencing.In 198 samples,25(12.6％)were low level mutations,33(16.7％)were high level mutations and 10(5.1％)were mixed high and low level mutations.In the analysis of related clinical factors,the total mutation rate and the low level mutation rate in the optimal period,failure period and warning period were gradually increased(total mutation rate,P=0.016;low level mutation rate,P=0.005).The mutation rate of the samples with additional chromosomal abnormalities was also significantly increased(P=0.009).The mutation rate of patients who received first-and second-line treatment was significantly lower than that of patients who received third-or higher-line treatment(P=0.006).Analysis based on variant allele frequency(VAF)of the mutation site was helpful to visually evaluate the clonal evolution status of TKI-resistance CML cells.Conclusion:High-throughput sequencing is more sensitive and accurate than Sanger sequencing in mutation detection,which is helpful to accurately and visually evaluate TKI treatment response and optimize treatment strategy for CML.

Objective:To explore the therapeutic efficacy and prognostic factors of induction therapy for secondary central nervous system lymphoma(SCNSL).Methods:Clinical data of patients diagnosed with SCNSL from 2010 to 2021 at Guangdong Provincial People's Hospital were retrospectively collected.A retrospective cohort study was performed on all and grouped patients to analyze the efficacy and survival.Multivariate logistic regression analysis was used to explore the adverse prognostic factors.Results:Thirty-seven diffuse large B-cell lymphoma patients with secondary central involvement were included in the research.Their 2-year overall survival(OS)rate was 46.01％and median survival time was 18.1 months.The 2-year OS rates of HD-MTX group and TMZ group were 34.3％and 61％,median survival time were 8.7 and 38.3 months,and median progression-free survival time were 8.1 and 47 months,respectively.Multivariate logistic regression analysis showed that age,sex,IPI,Ann Arbor stage were correlated with patient survival time.The median survival time of patients with CD79B,KMT2D,CXCR4.ERBB2,TBL1XR1,BTG2,MYC,MYD88,and PIM1 mutations was 8.2 months,which was lower than the overall level.Conclusion:HD-MTX combined with TMZ as the first-line strategy may improve patient prognosis,and early application of gene sequencing is beneficial for evaluating prognosis.