Childhood simple obesity has become a significant public health issue in China. Modern medicine primarily relies on lifestyle interventions and often suffers from poor long-term compliance， while pharmacological options are limited and associated with potential adverse effects. Traditional Chinese Medicine （TCM） has a long history in the prevention and management of this condition， demonstrating eight distinct advantages， including systematic theoretical foundation， diversified therapeutic approaches， definite therapeutic efficacy， high safety profile， good patient compliance， comprehensive intervention strategies， emphasis on prevention， and stepwise treatment protocols. Additionally， TCM is characterized by six distinctive features： the use of natural medicinal substances， non-invasive external therapies， integration of medicinal dietetics， simple exercise regimens， precise syndrome differentiation， and diverse dosage forms. By combining internal and external treatments， TCM facilitates individualized regimen adjustment and holistic regulation， demonstrating remarkable effects in improving obesity-related metabolic indicators， regulating constitutional imbalance， and promoting healthy behaviors. However， challenges remain， such as inconsistent operational standards， insufficient high-quality clinical evidence， and a gap between basic research and clinical application. Future efforts should focus on accelerating the standardization of TCM diagnosis and treatment， conducting multicenter randomized controlled trials， and fostering interdisciplinary integration， so as to enhance the scientific validity and international recognition of TCM in the prevention and treatment of childhood obesity.

ObjectiveTo investigate the correlation between neutrophil-to-lymphocyte ratio （NLR）， platelet-to-lymphocyte ratio （PLR）， systemic immune-inflammation index （SII） and the severity of intrauterine adhesions （IUA）. MethodsThe retrospective study included 380 patients who underwent transcervical resection of adhesions （TCRA） from December 2019 to March 2025. Based on the American Fertility Society （AFS） classification， patients were divided into mild （n=61）， moderate （n=225）， and severe （n=94） groups. NLR， PLR， and SII were calculated from preoperative blood tests. Statistical analyses included Kruskal-Wallis test and ordinal Logistic regression. ResultsNLR， PLR， and SII were significantly higher in the severe IUA group compared to the mild group （P<0.05）， with SII showing the strongest predictive ability （OR=1.004， P=0.001）. The number of intrauterine procedures was an independent risk factor （OR=1.27/level， P=0.016）. The predictive model ［Logit（P）=-0.676+0.241×operation times+0.004×SII］ effectively identified severe IUA cases. ConclusionInflammatory markers （particularly SII） are correlated with IUA severity and may serve as non-invasive tools for clinical assessment.

ObjectiveMagnetoencephalography (MEG), a non-invasive neuroimaging technique, meticulously captures the magnetic fields emanating from brain electrical activity. Compared with MEG based on superconducting quantum interference devices (SQUID), MEG based on optically pump magnetometer (OPM) has the advantages of higher sensitivity, better spatial resolution and lower cost. However, most of the current studies are clinical studies, and there is a lack of animal studies on MEG based on OPM technology. Pain, a multifaceted sensory and emotional phenomenon, induces intricate alterations in brain activity, exhibiting notable sex differences. Despite clinical revelations of pain-related neuronal activity through MEG, specific properties remain elusive, and comprehensive laboratory studies on pain-associated brain activity alterations are lacking. The aim of this study was to investigate the effects of inflammatory pain (induced by Complete Freund’s Adjuvant (CFA)) on brain activity in a rat model using the MEG technique, to analysis changes in brain activity during pain perception, and to explore sex differences in pain-related MEG signaling. MethodsThis study utilized adult male and female Sprague-Dawley rats. Inflammatory pain was induced via intraplantar injection of CFA (100 μl, 50% in saline) in the left hind paw, with control groups receiving saline. Pain behavior was assessed using von Frey filaments at baseline and 1 h post-injection. For MEG recording, anesthetized rats had an OPM positioned on their head within a magnetic shield, undergoing two 15-minute sessions: a 5-minute baseline followed by a 10-minute mechanical stimulation phase. Data analysis included artifact removal and time-frequency analysis of spontaneous brain activity using accumulated spectrograms, generating spectrograms focused on the 4-30 Hz frequency range. ResultsMEG recordings in anesthetized rats during resting states and hind paw mechanical stimulation were compared, before and after saline/CFA injections. Mechanical stimulation elevated alpha activity in both male and female rats pre- and post-saline/CFA injections. Saline/CFA injections augmented average power in both sexes compared to pre-injection states. Remarkably, female rats exhibited higher average spectral power 1 h after CFA injection than after saline injection during resting states. Furthermore, despite comparable pain thresholds measured by classical pain behavioral tests post-CFA treatment, female rats displayed higher average power than males in the resting state after CFA injection. ConclusionThese results imply an enhanced perception of inflammatory pain in female rats compared to their male counterparts. Our study exhibits sex differences in alpha activities following CFA injection, highlighting heightened brain alpha activity in female rats during acute inflammatory pain in the resting state. Our study provides a method for OPM-based MEG recordings to be used to study brain activity in anaesthetized animals. In addition, the findings of this study contribute to a deeper understanding of pain-related neural activity and pain sex differences.

ObjectiveTo investigate the expression level of HBV cccDNA in patients in the convalescence stage of hepatitis B virus-related acute-on-chronic liver failure （HBV-ACLF） and its correlation with HBV markers and liver histopathological changes. MethodsA total of 30 patients in the convalescence stage of HBV-ACL who were hospitalized in The Ninth Hospital of Nanchang from January 2015 to October 2023 were enrolled as liver failure group， and 9 patients with chronic hepatitis B （CHB）， matched for sex and age， were enrolled as control group. The content of HBV cccDNA in liver tissue was measured， and its correlation with clinical data and laboratory markers was analyzed. The independent-samples t test or the Mann-Whitney U test was used for comparison of continuous data between two groups， and a one-way analysis of variance or the Kruskal-Wallis H test was used for comparison between multiple groups； the Fisher’s exact test was used for comparison of categorical data between groups. A Spearman correlation analysis was performed. ResultsThe liver failure group had a significantly lower content of HBV cccDNA in liver tissue than the control group （-0.92±0.70 log₁₀ copies/cell vs -0.13±0.91 log₁₀ copies/cell， t=2.761， P=0.009）. In the liver failure group， there was no significant difference in the content of HBV cccDNA in liver tissue between the HBeAg-positive patients and the HBeAg-negative patients （P>0.05）； there was no significant difference in the content of HBV cccDNA in liver tissue between the patients with different grades （G0-G2， G3， and G4） of liver inflammatory activity （P>0.05）； there was no significant difference in the content of HBV cccDNA in liver tissue between the patients with different stages （S0-S2， S3， and S4） of liver fibrosis （P>0.05）； there was no significant difference in the content of HBV cccDNA in liver tissue between the patients with negative HBV DNA and those with positive HBV DNA （P>0.05）. For the liver failure group， the content of HBV cccDNA in liver tissue was positively correlated with the content of HBV DNA in liver tissue （r=0.426， P=0.043） and was not significantly correlated with the content of HBV DNA in serum （P>0.05）. ConclusionThere is a significant reduction in the content of HBV cccDNA in liver tissue in the convalescence stage of HBV-ACLF. HBV cccDNA exists continuously and stably in liver tissue and can better reflect the persistent infection and replication of HBV than HBV DNA in serum and liver tissue.

To investigate the impact of preoperative serum follicle-stimulating hormone (FSH) levels on the probability of testicular sperm retrieval, we conducted a study of nonobstructive azoospermic (NOA) men with different testicular volumes (TVs) who underwent microdissection testicular sperm extraction (micro-TESE). A total of 177 NOA patients undergoing micro-TESE for the first time from April 2019 to November 2022 in Shenzhen Zhongshan Obstetrics and Gynecology Hospital (formerly Shenzhen Zhongshan Urology Hospital, Shenzhen, China) were retrospectively reviewed. The subjects were divided into four groups based on average TV quartiles. Serum hormone levels in each TV group were compared between positive and negative sperm retrieval subgroups. Overall sperm retrieval rate was 57.6%. FSH levels (median [interquartile range]) were higher in the positive sperm retrieval subgroup compared with the negative outcome subgroup when average TV was <5 ml (first quartile [Q1: TV <3 ml]: 43.32 [17.92] IU l -1 vs 32.95 [18.56] IU l -1 , P = 0.048; second quartile [Q2: 3 ml ≤ TV <5 ml]: 31.31 [15.37] IU l -1 vs 25.59 [18.40] IU l -1 , P = 0.042). Elevated serum FSH levels were associated with successful micro-TESE sperm retrieval in NOA men whose average TVs were <5 ml (adjusted odds ratio [OR]: 1.06 per unit increase; 95% confidence interval [CI]: 1.01-1.11; P = 0.011). In men with TVs ≥5 ml, larger TVs were associated with lower odds of sperm retrieval (adjusted OR: 0.84 per 1 ml increase; 95% CI: 0.71-0.98; P = 0.029). In conclusion, elevated serum FSH levels were associated with positive sperm retrieval in micro-TESE in NOA men with TVs <5 ml. In men with TV ≥5 ml, increases in average TVs were associated with lower odds of sperm retrieval.
Humans ; Male ; Azoospermia/surgery* ; Sperm Retrieval/statistics & numerical data* ; Adult ; Follicle Stimulating Hormone/blood* ; Retrospective Studies ; Testis/pathology* ; Microdissection ; Organ Size

This study investigated the impact of metabolic syndrome (MetS) and its components on prostate volume (PV) in the general Chinese population. In total, 43 455 participants in The First Medical Center of the Chinese PLA General Hospital (Beijing, China) from January 1, 2012, to December 31, 2022, undergoing health examinations were included in the study. Participants were categorized into four groups according to PV quartiles: Q1 (PV ≤24.94 ml), Q2 (PV >24.94 ml and ≤28.78 ml), Q3 (PV >28.78 ml and ≤34.07 ml), and Q4 (PV >34.07 ml), with Q1 serving as the reference group. Logistic regression analyses were used to examine the association between MetS and PV, with subgroup analyses conducted by age. Among the participants, 18 787 (43.2%) were diagnosed with MetS. In the multivariate analysis model, a significant correlation between MetS and PV was observed, with odds ratios (ORs) increasing as PV increased (Q2, OR = 1.203, 95% confidence interval [CI]: 1.139-1.271; Q3, OR = 1.300, 95% CI: 1.230-1.373; and Q4, OR = 1.556, 95% CI: 1.469-1.648). Analysis of MetS components revealed that all components were positively associated with PV, with abdominal obesity showing the most significant effect. The number of MetS components was identified as a dose-dependent risk factor for elevated PV. The impact of MetS, its components, and component count on PV exhibited a decreasing trend with advancing age. Overall, the influence of MetS, its components, and component count on PV was predominantly observed in the age groups of 40-49 years and 50-59 years. Early intervention targeting MetS can significantly alleviate the increase in PV, particularly benefiting individuals aged 40-59 years who have abdominal obesity.
Humans ; Male ; Metabolic Syndrome/complications* ; Middle Aged ; Cross-Sectional Studies ; Aged ; Prostate/diagnostic imaging* ; Adult ; Age Factors ; Organ Size ; China/epidemiology* ; Obesity, Abdominal ; Risk Factors

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To construct a Z-score regression model for coronary artery diameter based on echocardiographic data from children in Sichuan Province and to establish a Z-score calculation formula. METHODS: A total of 744 healthy children who underwent physical examinations at Sichuan Provincial People's Hospital from January 2020 to December 2022 were selected as the modeling group, while 251 children diagnosed with Kawasaki disease at the same hospital from January 2018 to December 2022 were selected as the validation group. Pearson correlation analysis was conducted to analyze the relationships between coronary artery diameter values and age, height, weight, and body surface area. A regression model was constructed using function transformation to identify the optimal regression model and establish the Z-score calculation formula, which was then validated. RESULTS: The Pearson correlation analysis showed that the correlation coefficients for the diameters of the left main coronary artery, left anterior descending artery, left circumflex artery, and right coronary artery with body surface area were 0.815, 0.793, 0.704, and 0.802, respectively (P<0.05). Among the constructed regression models, the power function regression model demonstrated the best performance and was therefore chosen as the optimal model for establishing the Z-score calculation formula. Based on this Z-score calculation formula, the detection rate of coronary artery lesions was found to be 21.5% (54/251), which was higher than the detection rate based on absolute values of coronary artery diameter. Notably, in the left anterior descending and left circumflex arteries, the detection rate of coronary artery lesions using this Z-score calculation formula was higher than that of previous classic Z-score calculation formulas. CONCLUSIONS The Z-score calculation formula established based on the power function regression model has a higher detection rate for coronary artery lesions, providing a strong reference for clinicians, particularly in assessing coronary artery lesions in children with Kawasaki disease.
Humans ; Male ; Female ; Child, Preschool ; Child ; Coronary Artery Disease/diagnostic imaging* ; Infant ; Mucocutaneous Lymph Node Syndrome ; Regression Analysis ; Coronary Vessels/diagnostic imaging* ; Echocardiography ; Adolescent

OBJECTIVES: To evaluate the safety and efficacy of thiotepa (TT)-containing conditioning regimens for allogeneic hematopoietic stem cell transplantation (HSCT) in children with inborn errors of immunity (IEI). METHODS: Clinical data of 22 children with IEI who underwent HSCT were retrospectively reviewed. Survival after HSCT was estimated using the Kaplan-Meier method. RESULTS: Nine patients received a traditional conditioning regimen (fludarabine + busulfan + cyclophosphamide/etoposide) and underwent peripheral blood stem cell transplantation (PBSCT). Thirteen patients received a TT-containing modified conditioning regimen (TT + fludarabine + busulfan + cyclophosphamide), including seven PBSCT and six umbilical cord blood transplantation (UCBT) cases. Successful engraftment with complete donor chimerism was achieved in all patients. Acute graft-versus-host disease occurred in 12 patients (one with grade III and the remaining with grade I-II). Chronic graft-versus-host disease occurred in one patient. The incidence of EB viremia in UCBT patients was lower than that in PBSCT patients (P<0.05). Over a median follow-up of 36.0 months, one death occurred. The 3-year overall survival (OS) rate was 100% for the modified regimen and 88.9% ± 10.5% for the traditional regimen (P=0.229). When comparing transplantation types, the 3-year OS rates were 100% for UCBT and 93.8% ± 6.1% for PBSCT (P>0.05), and the 3-year event-free survival rates were 100% and 87.1% ± 8.6%, respectively (P>0.05). CONCLUSIONS TT-containing conditioning for allogeneic HSCT in children with IEI is safe and effective. Both UCBT and PBSCT may achieve high success rates.
Humans ; Retrospective Studies ; Transplantation Conditioning/methods* ; Thiotepa/therapeutic use* ; Hematopoietic Stem Cell Transplantation/adverse effects* ; Male ; Female ; Child, Preschool ; Infant ; Child ; Transplantation, Homologous ; Graft vs Host Disease ; Adolescent

BACKGROUND: It is inaccurate to reflect the level of dust exposure through working years. Furthermore, identifying a predictive indicator for lung function decline is significant for coal miners. The study aimed to explored whether club cell secretory protein (CC16) levels can reflect early lung function changes. METHODS: The cumulative respiratory dust exposure (CDE) levels of 1,461 coal miners were retrospectively assessed by constructed a job-exposure matrix to replace working years. Important factors affecting lung function and CC16 were selected by establishing random forest models. Subsequently, the potential of CC16 to reflect lung injury was explored from multiple perspectives. First, restricted cubic spline (RCS) models were used to compare the trends of changes in lung function indicators and plasma CC16 levels after dust exposure. Then mediating analysis was performed to investigate the role of CC16 in the association between dust exposure and lung function decline. Finally, the association between baseline CC16 levels and follow-up lung function was explored. RESULTS: The median CDE were 35.13 mg/m³-years. RCS models revealed a rapid decline in forced vital capacity (FVC), forced expiratory volume in the first second (FEV₁), and their percentages of predicted values when CDE exceeded 25 mg/m³-years. The dust exposure level (<5 mg/m³-years) causing significant changes in CC16 was much lower than the level (25 mg/m³-years) that caused changes in lung function indicators. CC16 mediated 11.1% to 26.0% of dust-related lung function decline. Additionally, workers with low baseline CC16 levels experienced greater reductions in lung function in the future. CONCLUSIONS CC16 levels are more sensitive than lung indicators in reflecting early lung function injury and plays mediating role in lung function decline induced by dust exposure. Low baseline CC16 levels predict poor future lung function.
Uteroglobin/blood* ; Humans ; Dust/analysis* ; Occupational Exposure/analysis* ; Male ; Middle Aged ; Adult ; Retrospective Studies ; Lung Injury/chemically induced* ; Coal Mining ; Biomarkers/blood* ; China/epidemiology* ; Air Pollutants, Occupational ; Female