1.Surveillance results of common diseases among primary and secondary school students in Yichang City in 2019 - 2022
Yi LIANG ; Zaoxia WANG ; Chi HU ; Xiaoyan MING ; Man XIAO ; Qian WU ; Zhongcheng YANG
Journal of Public Health and Preventive Medicine 2025;36(4):98-101
Objective To investigate the prevalence of common diseases among primary and secondary school students in Yichang City from 2019 to 2022, and to provide a scientific basis for formulating effective intervention measures in the future. Methods By random cluster sampling , 7 schools in urban areas and 5 schools in suburban counties were selected to screen common diseases such as myopia, dental caries, obesity and abnormal spinal curvature. Descriptive epidemiological methods were employed for statistical analysis. Results A total of 17 023 primary and secondary school students were screened from 2019 to 2022. The overall detection rate of common diseases from high to low was myopia (54.12%), caries (36.75%), overweight (15.17%), obesity (11.88%), malnutrition (5.80%), and abnormal spinal curvature (3.49%). The detection rates of myopia and abnormal curvature of the spine showed an increasing trend with years and school stages, while the detection rates of malnutrition and dental caries showed a decreasing trend with years and school stages. The detection rates of overweight and obesity showed no trend difference with years, and the detection rates of obesity showed a decreasing trend with school stages. The rates of myopia, overweight and obesity were higher in urban areas than those in suburban counties, and the rate of dental caries was higher in suburban counties than that in urban areas. The prevalence of overweight, obesity, and malnutrition in boys was higher than that in girls. The prevalence of myopia and dental caries in girls was higher than that in boys. The above differences were statistically significant (all P<0.05). Conclusion Myopia, dental caries, obesity, and abnormal curvature of the spine are the current focus of the prevention and treatment of common diseases in students. There are great differences between different regions, school stages, and genders. The “tripartite linkage” of schools, families, and communities should be achieved with the joint efforts of the education and health departments to actively take targeted intervention measures to reduce the prevalence.
2.Studies on pharmacological effects and chemical components of different extracts from Bawei Chenxiang Pills.
Jia-Tong WANG ; Lu-Lu KANG ; Feng ZHOU ; Luo-Bu GESANG ; Ya-Na LIANG ; Guo-Dong YANG ; Xiao-Li GAO ; Hui-Chao WU ; Xing-Yun CHAI
China Journal of Chinese Materia Medica 2025;50(11):3035-3042
The medicinal materials of Bawei Chenxiang Pills(BCPs) were extracted via three methods: reflux extraction by water, reflux extraction by 70% ethanol, and extraction by pure water following reflux extraction by 70% ethanol, yielding three extracts of ST, CT, and CST. The efficacy of ST(760 mg·kg~(-1)), CT(620 mg·kg~(-1)), and CST(1 040 mg·kg~(-1)) were evaluated by acute myocardial ischemia(AMI) and p-chlorophenylalanine(PCPA)-induced insomnia in mice, respectively. Western blot was further utilized to investigate their hypnosis mechanisms. The main chemical components of different extracts were identified by the UPLC-Q-Exactive-MS technique. The results showed that CT and CST significantly increased the ejection fraction(EF) and fractional shortening(FS) of myocardial infarction mice, reduced left ventricular internal dimension at end-diastole(LVIDd) and left ventricular internal dimension at end-systole(LVIDs). In contrast, ST did not exhibit significant effects on these parameters. In the insomnia model, CT significantly reduced sleep latency and prolonged sleep duration, whereas ST only prolonged sleep duration without shortening sleep latency. CST showed no significant effects on either sleep latency or sleep duration. Additionally, both CT and ST upregulated glutamic acid decarboxylase 67(GAD67) protein expression in brain tissue. A total of 15 main chemical components were identified from CT, including 2-(2-phenylethyl) chromone and 6-methoxy-2-(2-phenylethyl) chromone. Six chemical components including chebulidic acid were identified from ST. The results suggested that chromones and terpenes were potential anti-myocardial ischemia drugs of BCPs, and tannin and phenolic acids were potential hypnosis drugs. This study enriches the pharmacological and chemical research of BCPs, providing a basis and reference for their secondary development, quality standard improvement, and clinical application.
Animals
;
Drugs, Chinese Herbal/isolation & purification*
;
Mice
;
Male
;
Sleep Initiation and Maintenance Disorders/physiopathology*
;
Humans
;
Myocardial Infarction/drug therapy*
;
Myocardial Ischemia/drug therapy*
3.Modified Sini Powder in treating mild to moderate generalized anxiety disorder in patients with syndrome of liver depression transforming into fire: a single-center, randomized, double-blind, dose-controlled trial.
Jia-Xin XU ; Hong-Jun YANG ; Hong-Wei WU ; Li-Jun MAO ; Jian-Xin WANG ; Zong-Liang YU ; Yang ZHAO ; Xiao-Nan HAO ; Rui GAO
China Journal of Chinese Materia Medica 2025;50(14):4063-4070
A single-center, randomized, double-blind, dose-controlled trial of modified Sini Powder in treating mild to moderate generalized anxiety disorder(GAD) in the patients with syndrome of liver depression transforming into fire was conducted at Xiyuan Hospital, China Academy of Chinese Medical Sciences. A total of 80 patients with mild to moderate GAD and the syndrome of liver depression transforming into fire were included. Patients were assigned by the central randomization system at a ratio of 3∶1 into an observation group(n=60, receiving a conventional-dose of granules of modified Sini Powder) and a control group(n=20, receiving low-dose granules with the active ingredients being 50% of that in observation group). Assessments were conducted before treatment(baseline), after 2 weeks of introduction, after 2/4/8 weeks of treatment, and after 4 weeks of follow-up. The results were summarized as follows. In terms of primary outcome indicators, the observation group(62.2%) showed higher total response rate than the control group(26.6%)(P<0.05), and greater Hamilton anxiety scale(HAMA) score reduction after 8 weeks of treatment(P<0.05). In terms of secondary outcome indicators, the HAMA score(somatic anxiety score), traditional Chinese medicine(TCM) syndrome scores, Pittsburgh sleep quality index(PSQI) scale, and clinical global impression(CGI) scale score in the observation group showed a significant compared to the control group at each visit points(P<0.05). Adverse events occurred in 10 cases, including 9(16.9%) cases in the observation group and 1(6.6%) case in the control group. No adverse reaction was observed. In conclusion, conventional-dose modified Sini Powder demonstrated superior efficacy and favorable safety for mild and moderate GAD in the patients with the syndrome of liver depression transforming into fire over low-dose treatment.
Humans
;
Male
;
Female
;
Adult
;
Middle Aged
;
Double-Blind Method
;
Drugs, Chinese Herbal/administration & dosage*
;
Anxiety Disorders/drug therapy*
;
Treatment Outcome
;
Young Adult
;
Powders
;
Aged
;
Liver/drug effects*
;
Generalized Anxiety Disorder
4.Establishment of different pneumonia mouse models suitable for traditional Chinese medicine screening.
Xing-Nan YUE ; Jia-Yin HAN ; Chen PAN ; Yu-Shi ZHANG ; Su-Yan LIU ; Yong ZHAO ; Xiao-Meng ZHANG ; Jing-Wen WU ; Xuan TANG ; Ai-Hua LIANG
China Journal of Chinese Materia Medica 2025;50(15):4089-4099
In this study, lipopolysaccharide(LPS), ovalbumin(OVA), and compound 48/80(C48/80) were administered to establish non-infectious pneumonia models under simulated clinical conditions, and the correlation between their pathological characteristics and traditional Chinese medicine(TCM) syndromes was compared, providing the basis for the selection of appropriate animal models for TCM efficacy evaluation. An acute pneumonia model was established by nasal instillation of LPS combined with intraperitoneal injection for intensive stimulation. Three doses of OVA mixed with aluminum hydroxide adjuvant were injected intraperitoneally on days one, three, and five and OVA was administered via endotracheal drip for excitation on days 14-18 to establish an OVA-induced allergic pneumonia model. A single intravenous injection of three doses of C48/80 was adopted to establish a C48/80-induced pneumonia model. By detecting the changes in peripheral blood leukocyte classification, lung tissue and plasma cytokines, immunoglobulins(Ig), histamine levels, and arachidonic acid metabolites, the multi-dimensional analysis was carried out based on pathological evaluation. The results showed that the three models could cause pulmonary edema, increased wet weight in the lung, and obvious exudative inflammation in lung tissue pathology, especially for LPS. A number of pyrogenic cytokines, inclading interleukin(IL)-6, interferon(IFN)-γ, IL-1β, and IL-4 were significantly elevated in the LPS pneumonia model. Significantly increased levels of prostacyclin analogs such as prostaglandin E2(PGE2) and PGD2, which cause increased vascular permeability, and neutrophils in peripheral blood were significantly elevated. The model could partly reflect the clinical characteristics of phlegm heat accumulating in the lung or dampness toxin obstructing the lung. The OVA model showed that the sensitization mediators IgE and leukotriene E4(LTE4) were increased, and the anti-inflammatory prostacyclin 6-keto-PGF2α was decreased. Immune cells(lymphocytes and monocytes) were decreased, and inflammatory cells(neutrophils and basophils) were increased, reflecting the characteristics of "deficiency", "phlegm", or "dampness". Lymphocytes, monocytes, and basophils were significantly increased in the C48/80 model. The phenotype of the model was that the content of histamine, a large number of prostacyclins(6-keto-PGE1, PGF2α, 15-keto-PGF2α, 6-keto-PGF1α, 13,14-D-15-keto-PGE2, PGD2, PGE2, and PGH2), LTE4, and 5-hydroxyeicosatetraenoic acid(5S-HETE) was significantly increased, and these indicators were associated with vascular expansion and increased vascular permeability. The pyrogenic inflammatory cytokines were not increased. The C48/80 model reflected the characteristics of cold and damp accumulation. In the study, three non-infectious pneumonia models were constructed. The LPS model exhibited neutrophil infiltration and elevated inflammatory factors, which was suitable for the efficacy study of TCM for clearing heat, detoxifying, removing dampness, and eliminating phlegm. The OVA model, which took allergic inflammation as an index, was suitable for the efficacy study of Yiqi Gubiao formulas. The C48/80 model exhibited increased vasoactive substances(histamine, PGs, and LTE4), which was suitable for the efficacy study and evaluation of TCM for warming the lung, dispersing cold, drying dampness, and resolving phlegm. The study provides a theoretical basis for model selection for the efficacy evaluation of TCM in the treatment of pneumonia.
Animals
;
Disease Models, Animal
;
Mice
;
Pneumonia/genetics*
;
Medicine, Chinese Traditional
;
Male
;
Humans
;
Cytokines/immunology*
;
Female
;
Lipopolysaccharides/adverse effects*
;
Lung/drug effects*
;
Drugs, Chinese Herbal
;
Ovalbumin
;
Mice, Inbred BALB C
5.Short- to medium-term safety and efficacy of the implantable Corheart 6 left ventricular assist system in patients with end-stage heart failure
Zhibing QIU ; Xiaochun SONG ; Liangpeng LI ; Hongwei SHI ; Liqiong XIAO ; Yunzhang WU ; Xiaosong RONG ; Jidan FAN ; Liang WEI ; Xin CHEN
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(05):639-645
Objective To investigate the efficacy and safety of the Corheart 6 left ventricular assist system in patients with end-stage heart failure. Methods A retrospective study was conducted on patients with end-stage heart failure who were treated with Corheart 6 left ventricular assist system from March 2022 to June 2024 in 4 hospitals in Jiangsu Province. The efficacy of the device was evaluated by comparing changes in clinical indicators at preoperative, discharge, 3-month postoperative, and 6-month postoperative timepoints, including the New York Heart Association (NYHA) functional classification, left ventricular ejection fraction (LVEF), and left ventricular end-diastolic diameter (LVEDD). The safety of the device was assessed by analyzing the intraoperative position and orientation of the blood pump inlet cannula, as well as the incidence of adverse events. Results In this study, 39 patients were collected, including 34 males and 5 females with a mean age of (56.4±12.5) years, ranging from 20 to 75 years. There was no operative death. There was no death in postoperative 3 months with a survival rate of 100.0%. There were 3 deaths in 6 months postoperatively, with a survival rate of 92.3%. All patients had a preoperative NYHA cardiac function classification of class Ⅳ. The NYHA cardiac function class of the patients improved (P<0.05) at discharge, 3 and 6 months after surgery when compared to the preoperative period. LVEF was significantly higher at 3 months after surgery than that during the preoperative period (P<0.05). LVEDD was significantly smaller at discharge, 3 and 6 months after surgery than that during the preoperative period (P<0.05). The safety evaluation's findings demonstrated that all 39 patients' intraoperative blood pump inlet tubes were oriented correctly, the artificial blood vessel suture sites were appropriate, there were no instances of device malfunction or pump thrombosis, or instances of bleeding or hemolysis, and the rate of the remaining adverse events was low. Conclusion With a low rate of adverse events and an excellent safety profile, the Corheart 6 left ventricular assist system can efficiently enhance cardiac function in patients with end-stage heart failure. It also has considerable clinical uses.
6.Analyzing the influencing factors of occupational burnout among disease control and prevention staffs in Sichuan Province
Chaoxue WU ; Shuang DONG ; Liang WANG ; Xunbo DU ; Lin ZHAO ; Dan SHAO ; Quanquan XIAO ; Lijun ZHOU ; Chongkun XIAO ; Heng YUAN
China Occupational Medicine 2025;52(3):288-292
Objective To assess the situation and influencing factors of occupational burnout among the staff at the Center for Disease Control and Prevention (CDC) in Sichuan Province. Methods A total of 1 038 CDC staff members in Sichuan Province were selected as the study subjects using the stratified random sampling method. Occupational burnout of the staff was assessed using the Maslach Burnout Inventory General Survey via an online questionnaire. Results The detection rate of occupational burnout was 42.3% (439/1 038). Binary logistic regression analysis result showed that, after controlling for confounding factors such as education level and alcohol consumption, CDC staffs aged at 20-<31, 31-<41, and 41-<51 years were at higher risk of occupational burnout compared with those ≥51 years (all P<0.05). CDC staffs with 5-<10 or ≥10 years of service had higher occupational burnout risk compared with those with <5 years (both P<0.05). CDC staffs with poor or fair health status, irregular diet, and poor sleep quality had higher risk of occupational burnout compared with those healthy, have regular diet, and good sleep quality (all P<0.05). The risk of occupational burnout increased with higher overtime frequency (all P<0.05). Conclusion Occupational burnout among CDC staffs in Sichuan Province is relatively high. Age, years of service, health status, diet, sleep quality, and overtime frequency are key influencing factors.
7.Mechanism of Huayu jiedu formula in alleviating inflammatory injury in chronic kidney disease based on AIM2 pyroptosis pathway
Jinhuan XUE ; Ziwen WU ; Fan YANG ; Yunyun LOU ; Yingjun DING ; Yupeng XIAO ; Xianhui LIU ; Wenjie LIANG
China Pharmacy 2025;36(21):2638-2644
OBJECTIVE To explore the mechanism of Huayu jiedu formula in regulating inflammatory injury in chronic kidney disease (CKD). METHODS Fifty male SD rats were randomly divided into a sham surgery group (10 rats) and a modeling group (40 rats). The CKD model was replicated in the modeling group by unilateral ureteral obstruction surgery. After successful modeling, the rats were randomly divided into model group, esaxerenone group (positive control), and TCM low- and high-dose groups, with 10 rats in each group. The Esaxerenone group was given 1 mg/kg of esaxerenone, while the TCM low- and high-dose groups were given 13.7 and 27.4 g/kg of Huayu jiedu formula respectively, the sham surgery group and model group were given an equal volume of physiological saline, all groups were intervened continuously for 14 days. Hematoxylin eosin and Masson staining were used to observe the pathological changes in rat kidney tissue. Conventional biochemical methods were used to detect serum urea (SUr), serum creatinine (SCr), malondialdehyde (MDA), and superoxide dismutase (SOD) levels; enzyme-linked immunosorbent assay was used to detect the levels of serum interleukin-1β (IL-1β), IL-6, and tumor necrosis factor-α(TNF-α); immunohistochemistry and Western blot were used to detect the protein expression of peroxisome proliferator-activated receptor γ coactivator-1α(PGC-1α) , mitochondrial transcription factor A (TFAM), absent in melanoma 2(AIM2), caspase-1, gasdermin D (GSDMD), IL-1β and IL-18 in renal tissue; real-time fluorescence quantitative PCR was used to detect the mRNA expression of AIM2. RESULTS Compared with the sham surgery group, the renal tissue of the model group showed pathological changes such as glomerular deformation and destruction, severe tubular dilation, and increased deposition of blue fibrin; the levels of SUr, SCr, MDA, IL-1β, IL-6, TNF-α,the protein expression of AIM2, GSDMD, caspase-1, IL-1β, IL-18 , and the mRNA expression of AIM2 were significantly increased or up-regulated (P<0.01); the levels of SOD, the protein expression of PGC-1α, TFAM were significantly reduced or down-regulated (P<0.01). Compared with the model group, all treatment groups showed improvement in the above symptoms and most indicators in rats. CONCLUSIONS Huayu jiedu formula may improve renal function, alleviate renal inflammatory damage and pyroptosis, and exert renal protective effects by regulating the AIM2 pyroptosis pathway.
8."Component-effect" correlations in traditional Chinese medicine from holistic view: taking discovery of gintonin from ginseng as an example.
Xin-Ming YU ; Chen-Yu YU ; Hua-Ying WANG ; Wei-Sheng YUE ; Zhu-Bin ZHANG ; Wei WU ; Xiao-Bin JIA ; Bing YANG ; Liang FENG
China Journal of Chinese Materia Medica 2025;50(7):2001-2012
The holistic view is the key in the study of traditional Chinese medicine(TCM). The component structure theory is based on the holistic view to investigate the correlation between material basis and efficiency, which enriches the holistic "component-effect" research of TCM. Gintonin is a newly isolated non-saponin component of ginseng. Compared to ginsenosides, gintonin has many different pharmacological activities, and it provides new knowledge for the holistic research of ginseng. Thus, taking the discovery of gintonin from ginseng as an example, this paper explored the linkage between ginsenosides and gintonin from the perspective of "component-effect" correlations and systematically sorted out the similarities and differences between them in terms of structural characteristics, modes of action, and pharmacological activities. Starting from the collaborative interaction of TCM compounds, the study discussed the application and value of the holistic view in TCM "component-effect" research in the light of the component structure theory to provide new thoughts for the development of modern TCM research.
Panax/chemistry*
;
Drugs, Chinese Herbal/pharmacology*
;
Medicine, Chinese Traditional
;
Humans
;
Ginsenosides/pharmacology*
;
Animals
9.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
10.Clinical efficacy and safety of transcatheter aortic valve replacement for patients with severe pure native aortic regurgitation.
Jiantao CHEN ; Yi ZHANG ; Kangni FENG ; Suiqing HUANG ; Hanri XIAO ; Mengya LIANG ; Zhongkai WU
Journal of Zhejiang University. Medical sciences 2025;54(4):529-540
OBJECTIVES:
To evaluate the early clinical efficacy and safety of trans-catheter aortic valve replacement (TAVR) for patients with severe pure native aortic regurgitation (PNAR) who are not suitable for conventional surgical aortic valve replace-ment.
METHODS:
A retrospective analysis was conducted on 48 patients with PNAR who underwent TAVR at the Department of Cardiac Surgery, the First Affiliated Hospital of Sun Yat-sen University between March 2019 and February 2025. These included 25 cases with transfemoral approach (TF-TAVR group) and 23 cases with transapical approach (TA-TAVR group). Efficacy and safety were assessed by analyzing baseline characteristics, all-cause mortality, and procedure-related complications.
RESULTS:
Compared with the TA-TAVR group, the TF-TAVR group exhibited significantly smaller aortic annulus circumference and diameter, left ventricular outflow tract circumference and diameter, diameters of the left, right, and non-coronary sinuses, and sinotubular junction (STJ) diameter, along with a shorter distance from the STJ to the aortic annular plane ring plane, a smaller annulus angle (all P<0.05). Additionally, the TF-TAVR group showed a deeper prosthesis implantation depth relative to the aortic annular plane (P<0.01). The overall technical success rate was 91.67%, and the device success rate was 83.33%. Post-TAVR, both groups demonstrated significant improvement in left ventricular end-diastolic diameter (both P<0.05), while only the TA-TAVR group showed significant reduction in left ventricular end-systolic diameter (P<0.05). For primary outcomes, in-hospital mortality occurred in 2 patients (4.17%). No additional deaths were reported at 60 or 90 d after surgery. During 90-180 d after surgery, one patient in the TF-TAVR group died of sudden cardiac death, and one in the TA-TAVR group died of gastroin-testinal bleeding. During 180 d-1 year after surgery, one patient in the TF-TAVR group died of low cardiac output syndrome. No statistically significant differences were observed in 1-year Kaplan-Meier survival curves between the two groups (P>0.05). No conduction block events occurred in TA-TAVR group during hospitalization or 1-year follow-up, while high-grade atrioventricular block, left bundle branch block, permanent pacemaker implantation occurred in TF-TAVR group during hospitalization (12.00%, 4.00%, and 12.00%, respectively).
CONCLUSIONS
TAVR demonstrates high feasibility and acceptable safety for severe PNAR patients who are not suitable for conventional SAVR. Both TF-TAVR and TA-TAVR show comparable early postoperative efficacy and safety profiles.
Humans
;
Transcatheter Aortic Valve Replacement/adverse effects*
;
Aortic Valve Insufficiency/surgery*
;
Retrospective Studies
;
Male
;
Female
;
Aged
;
Treatment Outcome
;
Aortic Valve/surgery*
;
Aged, 80 and over
;
Heart Valve Prosthesis


Result Analysis
Print
Save
E-mail