OBJECTIVE: To establish a two-segment vertebrectomy model using the finite element method, and to measure and compare the biomechanical properties of the lower cervical anterior transpedicular root screw (ATPRS) plate system, lower cervical anterior pedicle screw (ATPS) plate system, and lower cervical anterior cervical locked-plate (ACLP) system on this model. METHODS: CT data of the cervical spine (C₀-T₁) from a 34-year-old healthy adult male volunteer were collected. A nonlinear complete model of the lower cervical spine (C₃-C₇) was established using Mimics 10.01 software, based on which the ATPRS fixation model, ATPS fixation model, and ACLP fixation model were constructed respectively. An axial pressure of 75 N and a pure couple moment of 1.5 N·m were applied to C3 to make the model perform flexion-extension, left-right lateral bending, and left-right rotation movements. The range of motion (ROM) and stress distribution of each model under different working conditions were compared. RESULTS: The ROM of the C₄-C₇ segments in the ACLP group, ATPS group, and ATPRS group was reduced to 0.65° (-95.2%), 0.58° (-95.7%), and 0.62° (-95.4%) respectively compared with the intact model during flexion-extension movement;during lateral bending movement, it was reduced to 0.58° (-95.2%), 0.51°(-95.8%), and 0.60° (-95.1%) respectively;during rotation movement, it was reduced to 1.17° (-89.6%), 1.26° (-88.8%), and 1.27°(-88.7%) respectively. In terms of the stress on the titanium mesh graft, the ATPS group and ATPRS group had the maximum load during extension and the minimum load during flexion. Compared with the ACLP group, the stress on the titanium mesh graft in ATPS and ATPRS decreased by (-33.7%) and (-15.8%) in flexion, (-29.4%) and (-13.2%) in extension, (-26.2%) and (-23.4%) in lateral bending, and (-18.8%) and (-5.4%) in rotation, respectively. In terms of bone-screw interface stress, the peak bone stress near the C₇ screw in the ACLP group, ATPS group, and ATPRS group increased by 49.2%, 45.0%, and 47.6% respectively compared with the peak bone stress near the C₄ screw during extension. However, during flexion and lateral bending, there was no significant difference in the peak bone stress near the C₄ and C₇ screws. During rotation, the difference between the peak bone stress near the C₄ screw and that near the C₇ screw showed that in the ACLP group, left rotation (37.6%) was similar to right rotation (36.7%), while in the ATPS group and ATPRS group, left rotation was lower than right rotation. CONCLUSION Compared with the ACLP group, the ATPS group and ATPRS group have greater fixation stiffness and more stable fixation. However, in rotational movement, due to the uneven distribution of fixation stiffness, the stress distribution during torsion is uneven, but it is still better than the ACLP group. This indicates that ATPRS, like ATPS, has good primary stability, providing favorable conditions for bone graft fusion.
Humans ; Finite Element Analysis ; Male ; Cervical Vertebrae/physiopathology* ; Adult ; Biomechanical Phenomena ; Bone Plates ; Bone Screws ; Range of Motion, Articular ; Fracture Fixation, Internal

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To evaluate the dynamic changes of glucocorticoid (GC) dose and the feasibility of GC discontinuation in rheumatoid arthritis (RA) patients under the background of Chinese medicine (CM). METHODS: This multicenter retrospective cohort study included 1,196 RA patients enrolled in the China Rheumatoid Arthritis Registry of Patients with Chinese Medicine (CERTAIN) from September 1, 2019 to December 4, 2023, who initiated GC therapy. Participants were divided into the Western medicine (WM) and integrative medicine (IM, combination of CM and WM) groups based on medication regimen. Follow-up was performed at least every 3 months to assess dynamic changes in GC dose. Changes in GC dose were analyzed by generalized estimator equation, the probability of GC discontinuation was assessed using Kaplan-Meier curve, and predictors of GC discontinuation were analyzed by Cox regression. Patients with <12 months of follow-up were excluded for the sensitivity analysis. RESULTS: Among 1,196 patients (85.4% female; median age 56.4 years), 880 (73.6%) received IM. Over a median 12-month follow-up, 34.3% (410 cases) discontinued GC, with significantly higher rates in the IM group (40.8% vs. 16.1% in WM; P<0.05). GC dose declined progressively, with IM patients demonstrating faster reductions (median 3.75 mg vs. 5.00 mg in WM at 12 months; P<0.05). Multivariate Cox analysis identified age <60 years [P<0.001, hazard ratios (HR)=2.142, 95% confidence interval (CI): 1.523-3.012], IM therapy (P=0.001, HR=2.175, 95% CI: 1.369-3.456), baseline GC dose ⩽7.5 mg (P=0.003, HR=1.637, 95% CI: 1.177-2.275), and absence of non-steroidal anti-inflammatory drugs use (P=0.001, HR=2.546, 95% CI: 1.432-4.527) as significant predictors of GC discontinuation. Sensitivity analysis (545 cases) confirmed these findings. CONCLUSIONS RA patients receiving CM face difficulties in following guideline-recommended GC discontinuation protocols. IM can promote GC discontinuation and is a promising strategy to reduce GC dependency in RA management. (Trial registration: ClinicalTrials.gov, No. NCT05219214).
Adult ; Aged ; Female ; Humans ; Male ; Middle Aged ; Arthritis, Rheumatoid/drug therapy* ; Glucocorticoids/therapeutic use* ; Medicine, Chinese Traditional ; Retrospective Studies

Functional dyspepsia (FD), characterized by persistent or recurrent dyspeptic symptoms without identifiable organic, systemic or metabolic causes, is an increasingly recognized global health issue. The objective of this guideline is to equip clinicians and nursing professionals with evidence-based strategies for the management and treatment of adult patients with FD using traditional Chinese medicine (TCM). The Guideline Development Group consulted existing TCM consensus documents on FD and convened a panel of 35 clinicians to generate initial clinical queries. To address these queries, a systematic literature search was conducted across PubMed, EMBASE, the Cochrane Library, China National Knowledge Infrastructure (CNKI), VIP Database, China Biology Medicine (SinoMed) Database, Wanfang Database, Traditional Medicine Research Data Expanded (TMRDE), and the Traditional Chinese Medical Literature Analysis and Retrieval System (TCMLARS). The evidence from the literature was critically appraised using the Grading of Recommendations Assessment, Development, and Evaluation (GRADE) approach. The strength of the recommendations was ascertained through a consensus-building process involving TCM and allopathic medicine experts, methodologists, pharmacologists, nursing specialists, and health economists, leveraging their collective expertise and empirical knowledge. The guideline comprises a total of 43 evidence-informed recommendations that span a range of clinical aspects, including the pathogenesis according to TCM, diagnostic approaches, therapeutic interventions, efficacy assessments, and prognostic considerations. Please cite this article as: Zhang SS, Zhao LQ, Hou XH, Bian ZX, Zheng JH, Tian HH, Yang GH, Hong WS, He YY, Liu L, Shen H, Li YP, Xie S, Shu J, Zeng BF, Li JX, Liu Z, Xiao ZH, Xiao JD, Zheng PY, Huang SG, Chen SL, Fei GJ. International clinical practice guideline on the use of traditional Chinese medicine for functional dyspepsia (2025). J Integr Med. 2025; 23(5):502-518.
Dyspepsia/drug therapy* ; Humans ; Medicine, Chinese Traditional/methods* ; Practice Guidelines as Topic ; Drugs, Chinese Herbal/therapeutic use*

OBJECTIVE: Poxviruses are zoonotic pathogens that infect humans, mammals, vertebrates, and arthropods. However, the specific role of ticks in transmission and evolution of these viruses remains unclear. METHODS: Transcriptomic and metatranscriptomic raw data from 329 sampling pools of seven tick species across five continents were mined to assess the diversity and abundance of poxviruses. Chordopoxviral sequences were assembled and subjected to phylogenetic analysis to trace the origins of the unblasted fragments within these sequences. RESULTS: Fifty-eight poxvirus species, representing two subfamilies and 20 genera, were identified, with 212 poxviral sequences assembled. A substantial proportion of AT-rich fragments were detected in the assembled poxviral genomes. These genomic sequences contained fragments originating from rodents, archaea, and arthropods. CONCLUSION Our findings indicate that ticks play a significant role in the transmission and evolution of poxviruses. These viruses demonstrate the capacity to modulate virulence and adaptability through horizontal gene transfer, gene recombination, and gene mutations, thereby promoting co-existence and co-evolution with their hosts. This study advances understanding of the ecological dynamics of poxvirus transmission and evolution and highlights the potential role of ticks as vectors and vessels in these processes.
Animals ; Poxviridae/physiology* ; Ticks/virology* ; Phylogeny ; Transcriptome ; Evolution, Molecular ; Poxviridae Infections/virology* ; Genome, Viral

Abstract In recent years, the prevalence of overweight and obesity among children and adolescents has risen rapidly, posing a serious threat to their physical and mental health. To provide scientific, systematic, and standardized weight management guidance for overweight and obese children and adolescents, the study focuses on the core concept of healthy lifestyle intervention, integrates multidisciplinary expert opinions and research findings,and proposes a comprehensive multidisciplinary intervention framework covering scientific exercise intervention, precise nutrition and diet, optimized sleep management, and standardized psychological support. It calls for the establishment of a multi agent collaborative management mechanism led by the government, implemented by families, fostered by schools, initiated by individuals, optimized by communities, reinforced by healthcare, and coordinated by multiple stakeholders. Emphasizing a child and adolescent centered approach, the consensus advocates for comprehensive, multi level, and personalized guidance strategies to promote the internalization and maintenance of a healthy lifestyle. It serves as a reference and provides recommendations for the effective prevention and control of overweight and obesity, and enhancing the health level of children and adolescents.

Objective:To investigate the correlation of peripheral blood T lymphocyte subsets with overall survival(OS)and clinical baseline characteristics in mantle cell lymphoma(MCL).Methods:The clinical data of 55 MCL patients who were newly diagnosed in the Department of Hematology,Second Hospital of Shanxi Medical University from January 2012 to July 2022 were analyzed retrospectively.The percentages of T lymphocyte subsets and CD4+/CD8+ratio in peripheral blood were detected by flow cytometry,and their correlation with clinical characteristics of patients were analyzed.Kaplan-Meier method was used for survival analysis and survival curves were drawn.Log-rank test was used for univariate analysis,while Cox proportional hazards model was used for multivariate analysis.Results:The median follow-up was 40(1-68)months,and the median overall survival(OS)was 47 months.Among the 55 patients,30(54.5％)patients had a decrease in peripheral blood CD4+T lymphocyte,while 17(30.9％)patients had a increase in peripheral blood CD8+T lymphocyte,and 20(36.4％)patients had a decrease in CD4+/CD8+ratio.There were no significant correlations between CD4+/CD8+ratio and sex,age,Ki-67,B symptoms,leukocytes,hemoglobin,lymphocytes,platelets,albumin,lactate dehydrogenase(LDH),β2-microglobulin,splenomegaly,bone marrow invasion,primary site and MIPI score.Survival analysis showed that patients with CD4+T cell＞23.3％,CD8+Tcell ≤33.4％and CD4+/CD8+ratio＞0.6 had longer OS(P=0.020,P＜0.001,P＜0.001).Univariate analysis showed that Ki-67＞30％,LDH＞250 U/L,splenomegaly,bone marrow involvement,CD4+T cells 23.3％,CD8+T cells＞33.4％,CD4+/CD8+ratio ≤0.6 were adverse prognostic factors affecting OS of MCL patients.Multivariate analysis showed that CD4+/CD8+ratio ≤0.6(HR=4.382,P=0.005)was an independent adverse prognostic factor for OS of MCL patients.Conclusions:Low CD4+/CD8+ratio is associated with poor prognosis in MCL,and the CD4+/CD8+ratio can be used as an important indicator to evaluate the prognosis risk in MCL patients.

This study aims to identify the main chemical compounds, investigate the effects of different drying methods on the quality, and determine the appropriate drying method of Callicarpae Nudiflorae Folium. UPLC-UV-Q-TOF-MS was employed to characterize and identify 35 main compounds, including phenylethanoid glycosides, flavonoids, and iridoids in Callicarpae Nudiflorae Folium. A method for the simultaneous determination of 8 compounds with strong UV absorption and high content was established to evaluate the quality of Callicarpae Nudiflorae Folium dried by different methods. UPLC-UV-Q-TOF-MS combined with principal component analysis(PCA) was employed to compare the Callicarpae Nudiflorae Folium samples treated by microwave drying at different power(119, 231, and 385 W), drying in the shade, sun drying, and oven drying at different temperatures(50, 60, 70, 80, 90, and 100 ℃). The total content of decaffeoyl acteoside, picroside Ⅲ, galuteolin, forsythin B, acteoside, isoacteoside, 6-hydroxyluteolin-7-glucoside, and caffeic acid in Callicarpae Nudiflorae Folium, as well as the content of most compounds, decreased with the rise in drying temperature and with the decrease in microwave power. Considering the content of compounds, low carbon, and energy saving, microwave drying at 231 W, low-temperature drying, or natural drying is recommended for the production of Callicarpae Nudiflorae Folium. This study provides a scientific basis for the selection of drying methods for Callicarpae Nudiflorae Folium at the place of origin and for the improvement of quality standards.
Desiccation/methods* ; Drugs, Chinese Herbal/chemistry* ; Callicarpa/chemistry* ; Plant Leaves/chemistry* ; Chromatography, High Pressure Liquid ; Flavonoids/analysis* ; Microwaves ; Mass Spectrometry

AIM:To observe the toxic effects of zinc oxide nanoparticles(ZnO NPs)on cornea by constructing intoxicated model in vivo and in vitro.METHODS:Human corneal epithelial cells(HCEpiC)were cultured in vitro and exposed to different concentrations(0.5, 5, 12.5, 25, 50, 100, 250 μg/mL)of ZnO NPs for 24h. The cell culture medium without nano-solution was used as the blank control group. The viability of the cells was assessed by MTT assay. Three different concentrations(25, 50 and 100 μg/mL)of ZnONPs dispersions were exposed to the conjunctival sac of anesthetized mice three times a day for 7d consecutively. The phosphate buffered saline(PBS)eye group was the PBS control group. Corneal morphology was observed on 1, 3, 5 and 7d, and the eyes were removed on 8d for various laboratory examinations, including corneal pathological changes and expression levels of inflammatory factors(TNF-α, IL-6).RESULTS:After treatment of HCEpiC cells with different concentrations of ZnO NPs for 24h, the MTT results showed that Zno NPs cause damage to cells at 0.5 μg/mL, and the cell survival rate was about 80%(P<0.05). Half of the cells were killed at a dose of 5 μg/mL, the damaging effect on cells in the concentration range of 5～250 μg/mL was concentration-dependent(P<0.0001). After 7d of conjunctival capsule spotting in mice, dot-like staining of fluorescein was seen in the 25 μg/mL ZnO NPs and 50 μg/mL ZnO NPs groups. Localized circular fluorescein stained areas were seen in the corneas of the 100 μg/mL ZnO NPs group. HE staining showed that the corneal epithelial layer, stromal layer thickness and stromal layer immune cell number did not change significantly in the 25 μg/mL and 50 μg/mL ZnO NPs groups(all P>0.05), while the corneal epithelial layer thinned, the corneal stromal layer thickened and the stromal layer immune cells increased significantly in the 100 μg/mL ZnO NPs group(all P<0.05). Immunohistochemical staining showed that the number of corneal stromal immune cells producing TNF-α and IL-6 and the mean integral optical density(IOD)values of TNF-α and IL-6 were significantly higher in the 100 μg/mL ZnO NPs group than in the PBS control group(P<0.05), and the degree of inflammation response was concentration-dependent. Compared with the PBS control group, no significant increase in immune cell count and IOD values in the 25 μg/mL ZnO NPs and 50 μg/mL ZnO NPs groups(P>0.05).CONCLUSION:The toxic damaging effect of ZnO NPs on the cornea was confirmed from both in vitro and in vivo, which provided a theoretical basis for the ocular safety evaluation of ZnO NPs.

Objective: To investigate the clinical characteristics, cytogenetics, molecular biology, treatment, and prognosis of patients with therapy-related myelodysplastic syndrome and acute myeloid leukemia (t-MDS/AML) secondary to malignancies. Methods: The clinical data of 86 patients with t-MDS/AML in West China Hospital of Sichuan University between January 2010 and April 2023 were retrospectively analyzed. The clinical characteristics, primary tumor types, and tumor-related therapies were analyzed. Results: The study enrolled a total of 86 patients with t-MDS/AML, including 67 patients with t-AML, including 1 patient with M(0), 6 with M(1), 27 with M(2), 9 with M(3), 12 with M(4), 10 with M(5), 1 with M(6), and 1 with M(7). Sixty-two patients could be genetically stratified, with a median overall survival (OS) of 36 (95% CI 22-52) months for 20 (29.9%) patients in the low-risk group and 6 (95% CI 3-9) months for 10 (14.9%) in the intermediate-risk group. The median OS time was 8 (95% CI 1-15) months in 32 (47.8%) patients in the high-risk group. For patients with non-acute promyelocytic leukemia (APL) and AML, the median OS of the low-risk group was 27 (95% CI 18-36) months, which was significantly longer than that of the non-low-risk group (χ(2)=5.534, P=0.019). All 9 APL cases were treated according to the initial treatment, and the median OS was not reached, and the 1-, 2-, and 3-year OS rates were 100.0%, (75.0±6.2) %, and (75.0±6.2) % respectively. Of the 58 patients with non-APL t-AML (89.7%), 52 received chemotherapy, and 16 achieved complete remission (30.8%) after the first induction chemotherapy. The 1-, 2-, and 3-year OS rates of the non-APL t-AML group were (42.0 ± 6.6) %, (22.9±5.7) %, and (13.4±4.7) %, respectively. The median OS of patients who achieved remission was 24 (95% CI 18-30) months, and the median OS of those who did not achieve remission was 6 (95% CI 3-9) months (χ(2)=10.170, P=0.001). Bone marrow CR was achieved in 7 (53.8%) of 13 patients treated with vineclar-containing chemotherapy, with a median OS of 12 (95% CI 9-15) months, which was not significantly different from that of vineclar-containing chemotherapy (χ(2)=0.600, P=0.437). In 19 patients with t-MDS, the 1-, 2-, and 3-year OS rates were (46.8±11.6) %, (17.5±9.1) %, and (11.7±9.1) % with a median OS of 12 (95% CI 7-17) months, which was not significantly different from that in t-AML (χ(2)=0.232, P=0.630) . Conclusions: Breast cancer, bowel cancer, and other primary tumors are common in patients with t-MDS/AML, which have a higher risk of adverse genetics. Patients with APL had a high induction remission rate and a good long-term prognosis, whereas patients without APL had a low remission rate and a poor long-term prognosis.
Humans ; Retrospective Studies ; Leukemia, Myeloid, Acute/drug therapy* ; Leukemia, Promyelocytic, Acute/therapy* ; Prognosis ; Myelodysplastic Syndromes/drug therapy* ; Neoplasms, Second Primary/drug therapy* ; Remission Induction ; Antineoplastic Combined Chemotherapy Protocols/therapeutic use*