1.Epidemiological characteristics and influencing factors of severe fever with thrombocytopenia syndrome in Zhejiang Province
LÜ ; Jing ; XU Xinying ; QIAO Yingyi ; SHI Xinglong ; YUE Fang ; LIU Ying ; CHENG Chuanlong ; ZHANG Yuqi ; SUN Jimin ; LI Xiujun
Journal of Preventive Medicine 2026;38(1):10-14
Objective:
To analyze the epidemiological characteristics and influencing factors of severe fever with thrombocytopenia syndrome (SFTS) in Zhejiang Province from 2019 to 2023, so as to provide the reference for strengthening SFTS prevention and control.
Methods:
Data on laboratory-confirmed SFTS cases in Zhejiang Province from 2019 to 2023 were collected through the Infectious Disease Reporting Information System of Chinese Disease Prevention and Control Information System. Meteorological data, geographic environment and socioeconomic factors during the same period were collected from the fifth-generation European Centre for Medium-Range Weather Forecasts, Geospatial Data Cloud, and Zhejiang Statistical Yearbook, respectively. Descriptive epidemiological methods were used to analyze the epidemiological characteristics of SFTS from 2019 to 2023, and a Bayesian spatio-temporal model was constructed to analyze the influencing factors of SFTS incidence.
Results:
A total of 578 SFTS cases were reported in Zhejiang Province from 2019 to 2023, with an annual average incidence of 0.23/105. The peak period was from May to July, accounting for 52.60%. There were 309 males and 269 females, with a male-to-female ratio of 1.15∶1. The cases were mainly aged 50-<80 years, farmers, and in rural areas, accounting for 82.53%, 77.34%, and 75.43%, respectively. Taizhou City and Shaoxing City reported more SFTS cases, while Shaoxing City and Zhoushan City had higher annual average incidences of SFTS. The Bayesian spatio-temporal interaction model showed good goodness of fit. The results showed that mean temperature (RR=1.626, 95%CI: 1.111-2.378) and mean wind speed (RR=1.814, 95%CI: 1.321-2.492) were positively correlated with SFTS risk, while altitude (RR=0.432, 95%CI: 0.230-0.829) and population density (RR=0.443, 95%CI: 0.207-0.964) were negatively correlated with SFTS risk.
Conclusions
SFTS in Zhejiang Province peaks from May to July. Middle-aged and elderly people and farmers are high-risk populations. Taizhou City, Shaoxing City, and Zhoushan City are high-incidence areas. Mean temperature, mean wind speed, altitude, and population density can all affect the risk of SFTS incidence.
2.Standardization of electronic medical records data in rehabilitation
Yifan TIAN ; Fang XUN ; Haiyan YE ; Ye LIU ; Yingxin ZHANG ; Yaru YANG ; Zhongyan WANG ; Meng ZHANG ; Xiaoxie LIU ; Yanyan YANG ; Bin ZENG ; Mouwang ZHOU ; Yuxiao XIE ; Guangxu XU ; Jiejiao ZHENG ; Mingsheng ZHANG ; Xiangming YE ; Fubiao HUANG ; Qiuchen HUANG ; Yiji WANG ; Di CHEN ; Zhuoying QIU
Chinese Journal of Rehabilitation Theory and Practice 2025;31(1):33-44
ObjectiveTo explore the data standard system of electronic medical records in the field of rehabilitation, focusing on the terminology and coding standards, data structure, and key content categories of rehabilitation electronic medical records. MethodsBased on the Administrative Norms for the Application of Electronic Medical Records issued by the National Health Commission of China, the electronic medical record standard architecture issued by the International Organization for Standardization and Health Level Seven (HL7), the framework of the World Health Organization Family of International Classifications (WHO-FICs), Basic Architecture and Data Standards of Electronic Medical Records, Basic Data Set of Electronic Medical Records, and Specifications for Sharing Documents of Electronic Medical Records, the study constructed and organized the data structure, content, and data standards of rehabilitation electronic medical records. ResultsThe data structure of rehabilitation electronic medical records should strictly follow the structure of electronic medical records, including four levels (clinical document, document section, data set and data element) and four major content areas (basic information, diagnostic information, intervention information and cost information). Rehabilitation electronic medical records further integrated information related to rehabilitation needs and characteristics, emphasizing rehabilitation treatment, into clinical information. By fully applying the WHO-FICs reference classifications, rehabilitation electronic medical records could establish a standardized framework, diagnostic criteria, functional description tools, coding tools and terminology index tools for the coding, indexing, functional description, and analysis and interpretation of diseases and health problems. The study elaborated on the data structure and content categories of rehabilitation electronic medical records in four major categories, refined the granularity of reporting rehabilitation content in electronic medical records, and provided detailed data reporting guidance for rehabilitation electronic medical records. ConclusionThe standardization of rehabilitation electronic medical records is significant for improving the quality of rehabilitation medical services and promoting the rehabilitation process of patients. The development of rehabilitation electronic medical records must be based on the national and international standards. Under the general electronic medical records data structure and standards, a rehabilitation electronic medical records data system should be constructed which incorporates core data such as disease diagnosis, functional description and assessment, and rehabilitation interventions. The standardized rehabilitation electronic medical records scheme constructed in this study can support the improvement of standardization of rehabilitation electronic medical records data information.
3.Analysis of factors influencing macular edema in patients with diabetes cataract after surgery
Ming LI ; Fang XU ; Zhijuan XU
International Eye Science 2025;25(1):140-143
AIM: To explore the risk factors of macular edema in patients with diabetes cataract after surgery, and provide reference for postoperative prevention and treatment.METHODS: A total of 55 diabetes cataract patients(55 eyes)with macular edema after phacoemulsification surgery at the ophthalmology department of Jiaozhou Central Hospital of Qingdao from January 2022 to January 2024 were selected as edema group. In addition, 59 patients(59 eyes)with diabetes cataract who received the same surgical treatment but did not develop macular edema were treated as control group, and the relationship between interferon-induced protein-10(IP-10), macrophage chemotactic protein-1(MCP-1), vascular endothelial growth factor(VEGF)and postoperative macular edema was analyzed.RESULTS:Age, diabetes course, best corrected visual acuity(BCVA), glycated hemoglobin(HbA1c), creatinine, levels of IP-10, MCP-1 and VEGF in aqueous humor in the edema group were higher than those in the control group(all P<0.05). The risk factors for postoperative macular edema in patients with diabetes cataract were prolonged duration of diabetes, BCVA, increased HbA1c, increased creatinine and IP-10 in aqueous fluid, increased MCP-1 and increased VEGF(all P<0.05).CONCLUSION:Macular edema after surgical treatment in diabetes cataract patients is associated with prolonged duration of diabetes, BCVA, HbA1c, creatinine, IP-10, MCP-1, and VEGF, and clinical interventions should be given in advance.
4.Investigation and analysis of drug use and pharmaceutical care in tight medical alliance in Wanzhou District of Chongqing
Suxin WAN ; Qiuyan SUN ; Caibing XU ; Li SHEN ; Hongmei GONG ; Wei FANG
China Pharmacy 2025;36(1):19-23
OBJECTIVE To investigate the use of drugs and the development of pharmaceutical care in the tight medical alliance (shorted for “medical alliance”) of Wanzhou District of Chongqing, and provide reference for the further construction of the medical alliance. METHODS A survey form was designed and distributed to 21 constituent units (5 leading units and 16 member units) of 5 medical alliances in Wanzhou District of Chongqing. The statistical analysis was conducted in aspects of basic drug allocation and use, pharmaceutical personnel team construction, the development of pharmaceutical care, and rational use of antibiotics. RESULTS Among the 21 constituent units, 4 leading units and 14 member units achieved the target for the proportion of essential drug procurement varieties, with a total compliance rate of 85.71%; 4 leading units and 13 member units achieved the target for the proportion of national essential drug allocation and usage amount, with a total compliance rate of 80.95%. The proportions of personnel with doctoral degrees in the 5 leading units and 16 member units were 1.71% and 0 respectively, and the proportions of personnel with senior professional titles were 8.56% and 1.63%, respectively. A total of 5 pharmacy or pharmaceutical combined outpatient clinics were set up in the 21 medical alliance units, and 5 clinical pharmacy information service platforms were established; all 5 leading units were able to regularly carry out clinical pharmacy projects, while only 4 out of 16 member units had conducted medical order review and evaluation. The proportions of irrational use of antibiotics in outpatient prescriptions and inpatient medical records of the 16 member units (4.81%, 5.21%) were significantly higher than those of the 5 leading units (2.80%, 4.00%). CONCLUSIONS The allocation and usage of national essential drugs in 21 constituent units from Wanzhou District of Chongqing are both in good standing. However, the data on the allocation of pharmaceutical professionals and the number, qualifications, and job titles of clinical pharmacists in member units are generally low. Moreover, the pharmaceutical service projects and service quality in member units need to be further improved.
5.The Effect of Banxia Xiexin Decoction (半夏泻心汤) on the Expression of LXRα in Liver Tissue and the JAK2/STAT3 Signaling Pathway in Gastric Antrum Tissue of Diabetic Gastroparesis Model Rats
Qi XU ; Nuobing RUAN ; Jinju LI ; Xijuan LYU ; Zhaohui FANG
Journal of Traditional Chinese Medicine 2025;66(2):178-187
ObjectiveTo explore the potential mechanism of Banxia Xiexin Decoction (半夏泻心汤, BXD) in the treatment of diabetic gastroparesis (DGP). MethodsA total of 29 SD rats were randomly divided into four groups, blank group (5 rats) and model group, BXD group and metformin group (8 rats in each group). Except for the blank group, rats were administered intraperitoneally with 1% streptozotocin (STZ) solution and were fed a high-sugar, high-fat diet to establish the DGP rat model. After successful modeling, the BXD group was treated with BXD at 6.68 g/(kg·d) by gavage, the metformin group was treated with metformin hydrochloride at 105 mg/(kg·d) by gavage, and the blank group and the model group were treated with normal saline at 6.68 ml/(kg·d) by gavage, for 8 weeks. After the last administration, fasting blood glucose (FBG), glycated hemoglobin (HbA1c), total cholesterol (TC), triglycerides (TG) were measured and gastric emptying rate was calculated. ELISA was used to detect the levels of gastrointestinal hormones motilin (MTL) and gastrin (GAS), as well as inflammatory factors including tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), interleukin-1β (IL-1β) and interleukin-10 (IL-10) in gastric tissue. Oil red O staining was performed to observe liver pathological morphology. Hematoxylin and eosin (HE) staining was used to observe gastric antrum tissue morphology. Immunofluorescence staining was used to detect liver X receptor α (LXRα) levels in the liver. Western Blot was used to detect the protein levels of LXRα in liver tissue, and of janus kinase 2 (JAK2), phospho-janus kinase 2 (p-JAK2), signal transducer and activator of transcription 3 (STAT3) and phospho-signal transducer and activator of transcription 3 (p-STAT3) in gastric antrum tissue. Quantitative real-time polymerase chain reaction (qPCR) was used to measure the mRNA expression of LXRα in liver tissue and JAK2, STAT3 in gastric antrum tissue. ResultsCompared with the blank group, the model group showed significant hepatic fatty degeneration, gastric antrum tissue structure destruction, and increases in FBG, HbA1c, TC, and TG levels; the average fluorescence intensity, protein level, and mRNA expression of LXRα in liver tissue were reduced; the gastric emptying rate and gastric tissue GAS and MTL levels decreased; inflammatory factors including TNF-α, IL-6, IL-1β in gastric tissue increased, IL-10 decreased; in gastric antrum tissue, the mRNA expression of p-JAK2/JAK2, p-STAT3/STAT3, and JAK2 and STAT3 increased (P<0.01). Compared with the model group, both the BXD group and the metformin group showed improved liver and gastric antrum tissue pathology; FBG, HbA1c, TC, and TG levels decreased, while LXRα fluorescence intensity, protein level, and mRNA expression in liver tissue significantly increased; the gastric emptying rate and the levels of GAS and MTL in gastric tissue were markedly higher; the levels of TNF-α, IL-6, and IL-1β decreased, whereas IL-10 levels increased, p-JAK2/JAK2, p-STAT3/STAT3, and the mRNA expression of JAK2 and STAT3 in gastric antrum tissue decreased (P<0.05 or P<0.01). The BXD group showed higher level than the metformin group in FBG, HbA1c, and TG levels, lower level in gastric emptying rate and gastric tissue GAS content, and higher level in gastric tissue TNF-α, IL-6, IL-1β levels; there was also a decrease in IL-10 levels, and a reduction in LXRα fluorescence intensity and mRNA expression in liver tissue, as well as in p-JAK2/JAK2 levels in gastric antrum tissue (P<0.05 or P<0.01). ConclusionBXD can reduce blood glucose and lipid levels in DGP model rats while improving gastric function and alleviating gastric tissue inflammation. Its mechanism may be related to the regulation of LXRα expression in liver tissue and the JAK2/STAT3 pathway in gastric antrum tissue.
6.Urban-rural difference in adverse outcomes of pulmonary tuberculosis in patients with pulmonary tuberculosis-diabetes mellitus comorbidity
FANG Zijian ; LI Qingchun ; XIE Li ; SONG Xu ; DAI Ruoqi ; WU Yifei ; JIA Qingjun ; CHENG Qinglin
Journal of Preventive Medicine 2025;37(1):7-11
Objective:
To investigate the urban and rural differences in adverse outcomes of pulmonary tuberculosis (PTB) in patients with pulmonary tuberculosis-diabetes mellitus comorbidity (PTB-DM), so as to provide insights into improving the prevention and treatment measures for PTB-DM.
Methods:
Patients with PTB-DM who were admitted and discharged from 14 designated tuberculosis hospitals in Hangzhou City from 2018 to 2022 were selected. Basic information, and history of diagnosis and treatment were collected through hospital information systems. The adverse outcomes of PTB were defined as endpoints, and the proportions of adverse outcomes of PTB in urban and rural patients with PTB-DM were analyzed. Factors affecting the adverse outcomes of PTB were identified using a multivariable Cox proportional hazards regression model.
Results:
A total of 823 patients with PTB-DM were enrolled, including 354 (43.01%) urban and 469 (56.99%) rural patients. There were 112 (13.61%) patients with adverse outcomes of PTB. The proportions of adverse outcomes of PTB in urban and rural patients were 14.41% and 13.01%, respectively, with no statistically significant difference (P>0.05). Multivariable Cox proportional hazards regression analysis identified first diagnosed in county-level hospitals or above (HR=2.107, 95%CI: 1.181-3.758) and drug resistance (HR=3.303, 95%CI: 1.653-6.600) as the risk factors for adverse outcomes of PTB in urban patients with PTB-DM, while the treatment/observed management throughout the process (HR=0.470, 95%CI: 0.274-0.803) and fixed-dose combinations throughout the process (HR=0.331, 95%CI: 0.151-0.729) as the protective factors for adverse outcomes in rural patients with PTB-DM.
Conclusions
There are differences in influencing factors for adverse outcomes of PTB in urban and rural patients with PTB-DM. The adverse outcomes of PTB are associated with first diagnosed hospitals and drug resistance in urban patients, and are associated with the treatment/observed management and fixed-dose combinations throughout the process in rural patients.
7.Correlation between fundus blood flow parameters and carotid artery ultrasound blood flow parameters in patients with hypertensive retinopathy
Fang YUAN ; Wenxiu XIA ; Peiqiu XU ; Yawei LI ; Junchen CHEN ; Xiaoling ZHANG
International Eye Science 2025;25(2):306-310
AIM: To investigate the correlation between fundus blood flow parameters and carotid artery ultrasound blood flow parameters in patients with hypertensive retinopathy(HRP).METHODS: A total of 50 patients(22 left eyes and 28 right eyes)with HRP admitted to our hospital from June 2021 to June 2023 were retrospectively included as the experimental group, and 50 healthy physical examination subjects(22 left eyes and 28 right eyes)during the same period were included as the healthy group. Pearson correlation was used to analyze the correlation between fundus blood flow parameters and carotid artery ultrasound blood flow parameters.RESULTS: The AUC values of fundus blood flow parameters and carotid artery ultrasound blood flow parameters and their combined diagnosis of HRP were 0.853, 0.844 and 0.935, respectively. Pearson correlation analysis showed that carotid systolic peak blood flow velocity was negatively correlated with foveal avascular zone(FAZ)area, FAZ circumference and non-circularity index, and positively correlated with macular vascular density(all P<0.05). The end-diastolic blood flow velocity was positively correlated with FAZ area and macular vascular density(all P<0.05). The internal carotid artery resistance index was positively correlated with FAZ area(P<0.05).CONCLUSION: The combination of fundus blood flow parameters and carotid artery ultrasound blood flow parameters in the diagnosis of HRP has good application value in the diagnosis of HRP.
8.Establishment and stress analysis of a finite element model for adolescent cervical disc herniation
Yuxin ZHAO ; Liang LIANG ; Feng JIN ; Yangyang XU ; Zhijie KANG ; Yuan FANG ; Yujie HE ; Xing WANG ; Haiyan WANG ; Xiaohe LI
Chinese Journal of Tissue Engineering Research 2025;29(3):448-454
BACKGROUND:Cervical disc herniation can cause pain in the neck and shoulder area,as well as radiating pain in the upper limbs.The incidence rate is increasing year by year and tends to affect younger individuals.Fully understanding the biomechanical characteristics of the cervical spine in adolescents is of great significance for preventing and delaying the onset of cervical disc herniation in this age group. OBJECTIVE:To reconstruct cervical spine models for both healthy adolescents and adolescent patients with cervical disc herniation utilizing finite element analysis techniques,to analyze the motion range of the C1-T1 cervical vertebrae as well as the biomechanical characteristics of the annulus fibrosus,nucleus pulposus,endplates,and the cartilage of the small joints. METHODS:A normal adolescent's cervical spine and an adolescent patient with cervical disc herniation were selected in this study.The continuous scan cervical spine CT raw image data were imported into Mimics 21.0 in DICOM format.The C1-T1 vertebrae were reconstructed separately.Subsequently,the established models were imported into the 3-Matic software for disc reconstruction.The perfected models were then imported into Hypermesh software for meshing of the vertebrae,nucleus pulposus,annulus fibrosus,and ligaments,creating valid geometric models.After assigning material properties,the final models were imported into ABAQUS software to observe the joint motion range of the C1-C7 cervical vertebrae segments under different conditions,and to analyze the biomechanical characteristics of the annulus fibrosus,nucleus pulposus,endplates,and small joint cartilage of each cervical spine segment. RESULTS AND CONCLUSION:(1)In six different conditions,the joint motion range of the C1 vertebra in the cervical spine models of both normal adolescent and adolescent patient with cervical disc herniation was higher than that of the other vertebrae.Additionally,the joint motion range of each cervical spine segment in normal adolescent was greater than that in adolescent patient with cervical disc herniation.(2)In the cervical spine model of normal adolescent,the maximum stress values in the annulus fibrosus and nucleus pulposus were found on the left side during C2-3 flexion conditions(0.43 MPa and 0.17 MPa,respectively).In the cervical spine model of adolescent patient with cervical disc herniation,the maximum stress values were found on the left side during C7-T1 flexion conditions(0.54 MPa and 0.18 MPa,respectively).(3)In the cervical spine model of normal adolescent,the maximum stress value on the endplate was found on the left side of the upper endplate of C3 during flexion conditions(1.46 MPa).In the model of adolescent patient with cervical disc herniation,the maximum stress value on the endplate was found on the left side of the lower endplate of C7 during flexion conditions(1.32 MPa).(4)In the cervical spine model of normal adolescent,the maximum stress value in the small joint cartilage was found in the C2-3 left rotation conditions(0.98 MPa).In adolescent patient with cervical disc herniation,the stress in the small joint cartilage significantly increased under different conditions,especially in C1-2,with the maximum stress found during left flexion(3.50 MPa).(5)It is concluded that compared to normal adolescent,adolescent patient with cervical disc herniation exhibits altered cervical curvature and a decrease in overall joint motion range in the cervical spine.In adolescent with cervical disc herniation,there is a significant increase in stress on the annulus fibrosus,nucleus pulposus,and endplates in the C7-T1 segment.The stress on the left articular cartilage of the C1-2 is notable.Abnormal cervical curvature may be the primary factor causing these stress changes.
9.Gradient artificial bone repair scaffold regulates skeletal system tissue repair and regeneration
Yu ZHANG ; Ruian XU ; Lei FANG ; Longfei LI ; Shuyan LIU ; Lingxue DING ; Yuexi WANG ; Ziyan GUO ; Feng TIAN ; Jiajia XUE
Chinese Journal of Tissue Engineering Research 2025;29(4):846-855
BACKGROUND:Gradient artificial bone repair scaffolds can mimic unique anatomical features in musculoskeletal tissues,showing great potential for repairing injured musculoskeletal tissues. OBJECTIVE:To review the latest research advances in gradient artificial bone repair scaffolds for tissue engineering in the musculoskeletal system and describe their advantages and fabrication strategies. METHODS:The first author of the article searched the Web of Science and PubMed databases for articles published from 2000 to 2023 with search terms"gradient,bone regeneration,scaffold".Finally,76 papers were analyzed and summarized after the screening. RESULTS AND CONCLUSION:(1)As an important means of efficient and high-quality repair of skeletal system tissues,gradient artificial bone repair scaffolds are currently designed bionically for the natural gradient characteristics of bone tissue,bone-cartilage,and tendon-bone tissue.These scaffolds can mimic the extracellular matrix of native tissues to a certain extent in terms of structure and composition,thus promoting cell adhesion,migration,proliferation,differentiation,and regenerative recovery of damaged tissues to their native state.(2)Advanced manufacturing technology provides more possibilities for gradient artificial bone repair scaffold preparation:Gradient electrospun fiber scaffolds constructed by spatially differentiated fiber arrangement and loading of biologically active substances have been developed;gradient 3D printed scaffolds fabricated by layered stacking,graded porosity,and bio-3D printing technology;gradient hydrogel scaffolds fabricated by in-situ layered injections,simple layer-by-layer stacking,and freeze-drying method;and in addition,there are also scaffolds made by other modalities or multi-method coupling.These scaffolds have demonstrated good biocompatibility in vitro experiments,were able to accelerate tissue regeneration in small animal tests,and were observed to have significantly improved histological structure.(3)The currently developed gradient artificial bone repair scaffolds have problems such as mismatch of gradient scales,unclear material-tissue interactions,and side effects caused by degradation products,which need to be further optimized by combining the strengths of related disciplines and clinical needs in the future.
10.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.


Result Analysis
Print
Save
E-mail