1.Correlation of invasive central arterial pressure with peripheral arterial pressure and coronary sclerosis
Qi WU ; Congcong XU ; Jiang LIU ; Qi CHEN ; Yanqing WU
Chinese Journal of Geriatrics 2013;(5):479-482
Objective To study the consistency among non-invasive and invasive brachial artery pressure,radial artery pressure and invasive central arterial pressure,and to explore the correlation between the severe degree of coronary artery disease and invasive central aortic pressure.Methods A total of 331 patients who underwent coronary angiography in our hospital were selected.The invasive central aortic pressure,invasive and non-invasive brachial arterial pressure,radial artery pressure in all patients were measured.The severe degrees of atherosclerosis were recorded.The differences among invasive brachial arterial pressure and invasive radial artery pressure,non-invasive brachial artery pressure and non-radial artery pressure and invasive central aortic pressure were compared.Results The systolic pressure values measured in invasive and non-invasive brachial artery and radial artery were higher than that measured by central aortic pressure,while the diastolic pressure values measured in the four peripheral artery were lower than that measured in central aorta.The pressure values measured by non-invasive brachial artery pressure were more close to that measured by invasive central aortic pressure (P>0.05).The systolic pressure was increased and the diastolic pressure was reduced in central aortic pressure with the coronary vessel lession numbers increased.The values of systolic pressure in patients with single-vessel,double-vessel and triple-vessel lesions were (118.2± 19.5) mm Hg,(124.9 ± 19.7) mm Hg and (137.7 ± 20.6) mm Hg,respectively and the values of diastolic pressure were (86.8±8.4) mm Hg,(85.3± 10.3) mm Hg and (83.1± 9.4) mm Hg,respectively.There were significant differences in systolic and diastolic pressure values among patients with single-vessel lesions,double vessel lesions and triple-vessel lesions(F=3.93,4.31,both P< 0.05).Conclusions The blood pressure values measured by noninvasive brachial artery pressure are more close to that measured by invasive central aortic pressure.There is a significant correlation between the severe degree of coronary heart disease and invasive central aortic pressure.Non invasive brachial artery pressure can be used in the early detection of cardiovascular dysfunction.
2.Transcatheter closure of perimembrane ventricular septal defects with Amplartzer occluder device in children:A preliminary results of clinical application
Rongzhou WU ; Qi CHEN ; Maoping CHU
Journal of Interventional Radiology 2004;0(S2):-
Objective To evaluate the efficiency and preliminary results of transcatheter closure of perimembrane ventricular septal defects (PMVSD) using Amplartzer occluder device in children.Methods There were 5 children using transthoracic echocardiography(TTE) to confirm the PMVSD before the intervention. The diameters of the PMVSD were measured by angiography; Each of the children were treated with Amplartzer occluder device for transcatheter closure of PMVSD under TTE and fluoroscopy. The TTE and elec-trocardiograph(ECG)、chest X-ray were performed 24 hours,1 and 3、6 months after the procedure to evaluate the therapeutic effect. Results The mean diameter of the PMVSDs measured by angiography was 5.0?2.4 mm(Ranging from 2.5 to 8.3 mm). The mean diameter of the occluder selected was 7.4?3.2 mm(Ranging from 4 to 10 mm). The success rate was 100%, and no complication occurred during the procedure. No residual shunts were found by angiography immediately after the procedure in all cases. There were no malpositions of occluder and no residual shunts in the 5 cases by TTE after the procedure 24 hours , 1 and 3、 6 months. There were no cardiac arrhythmia found by ECG. It showed that both pulmonary vascularity were improved.Conclusions Transcatheter closure of perimembrane ventricular septal defects using Amplartzer occluder device is an efficient therapy for children with PMVSD. The operation is simple with a high success rate of placement and a good occlusion effect. Further studies of long term results are required.
3.Dissection of helical ventricular ventricular myocardial band in the heart of swine with sparing of coronary system
Nan CHEN ; Mingying WU ; Hongwei QI
Chinese Journal of Thoracic and Cardiovascular Surgery 2009;25(3):193-196
Objective Based on the Helical Ventricular Myocardial Band (HVMB) theory proposed by Torrent-Guasp,the ventricular myocardial hand extends from the root of the pulmonary artery to the root of the aorta with two helical coils.This new theory is considered as a revolutionary concept for further understanding the global, three-dimensional and functional architecture of the ven- tricular myocardium. No repot had described techniques for disecting HVMB while keepin~ the integrity of the coronmy artery sys- tern. We explored techniques for dissecting HVMB in swine.Methads 33 fresh swine hearts were randomly divided intoll groups, 3 bearts in each. 160% barium sulfate (type I)suspmmion was injected into the coronary artery system. The coronary arteries were li- gated. The strial tissue was removed following puuing the hearts in boiling water then cooling for several hours. The superficial coro- nary vessels and fat tissue around the atrio-ventricular taxi inter-ventricular sulcus we~'e preserved. Some branches of the left anterior descending artery, distal segment, of posterior descending branch, and middle and distal segment of obtuse marginal branches were mu- tilated appropriately. HVMB dissection was completed with fingers in accordnce with Torrent Guasp' s technique. Results A contin- ued bundle of muscle, originated at the root of pulmonary artery and ended at the root of aorta, was unwrapped along the major dire- tion of the cardiac muscle fiber in all of the 33 hearts with spating of the coronary artery. The swine hearts' ventricular myocandium was cumosed of two loops, with basal loop firm the root of the pulmonart artery to the anterior papillary muscle and apical from the beginning of the anterior papillary muscle to the root tithe aorta. Each loop consisted of two segments: the right segment-coincid- ing with the right ventricular free wall and the left segment-coinciding with the basal d the left ventricular free wall. Posterior papillary muscle, which belongs to the descendant segment, denmrcated the border between the descendent and the ascendant of the HVMB's apical loop. Conclusion Although controversies about the theory of the HVMB remain, we have dissected the HVMB in the swine hearts' ventricular myocardium successfully with sparing of the coronary artery systems. This dissection procedure provides technical information for the studies of associated diseases based on the theory of HVMB.
4.Dynamic observation the change of reversed diastolic flow in renal allografts with ultrasound
Shunping CHEN ; Yuanping HU ; Qi WU
Chinese Journal of Urology 2010;31(11):764-766
Objective To retrospectively analyze the change of reversed diastolic flow in renal allografts with ultrasound and its association with clinical outcomes.Methods 17 patients with reverse diastolic flow of renal allograft were reviewed. According to the waveform morphology changes of RDF,17 cases of RDF were classified as two types: typeⅠ(total RDF changing type: continuous total RDF or non-total RDF transformed into total RDF,n=6)and type Ⅱ (non-total RDF changing type: continuous non-total RDF or total RDF transformed into non-total RDF or disappeared,n=11).Meanwhile,they were compared with clinical outcome.Results In typeⅠ, transplanted kidney resection were performed in five cases, but 10 cases in type Ⅱ were recovered. TypeⅠwas associated with lower likelihood of renal allografts survival(Fisher exact test, P=0.005).Conclusions Dynamic observation the change of RDF may help to judge the prognosis in renal allograft.TypeⅠmay predict of an unfavorable outcome in renal allograft with RDF.
5.Reversed diastalic flow in abdominal and peripheral vascularity and its value of clinical application
Shunping CHEN ; Yuanping HU ; Qi WU
Chinese Journal of Postgraduates of Medicine 2009;32(36):10-12
Objective To study the reversed diastolic flow in abdominal and peripheral vascularity and its value of clinical application.Methods A review of Doppler sonograms was performed in abdominal and peripheral vascularity obtained over a 9-year period.And if the patients with reversed diastolic flow were found,their clinical feature were recorded and evaluated.Results Sixty-eight patients with reversed diastolic flow were found including subelavian steal syndrome(21 cases),complications of renal transplant (22 cases),thrombosis in arteriovenous fistulas (20 cases),preeclampsia in pregnancy (3 cases) and others (2 cases).The causes of reversed diastolic flow in abdominal and peripheral vascularity might be divided into four types: vessels type(41 cases),organ type (22 cases),pregnancy type (3 cases) and others (2 cases).Conclusion The causes of patients of reversed diastolic flow in abdominal and peripheral vascuhrity are different depending on its site,and the typing of causes of reversed diastolic flow may aid to enhance the recognition of reversed diastolic flow.
6.It’s Time for This“ROSE”to Flower:Rapid on Site Evaluation in Interventional Pulmonology
Jing FENG ; Baoyuan CHEN ; Qi WU
Tianjin Medical Journal 2014;(3):193-196
Rapid on site evaluation (ROSE) technology of interventional pulmonology includes“cytological ROSE”(C-ROSE) and“microbiological ROSE”(M-ROSE). Recently, this“ROSE”has gradually become one of core technologies in modern interventional pulmonology. In this commentary, perspectives on origin and development, classification and clini-cal value, operational approach, clinical application, and how to carry out effective work related to ROSE were summarized and remarked.
7.Clinical Analysis of Patients with Primary Intestinal Tumous:A Report of 68 Cases
Jiayu LIN ; Yugang WU ; Qi CHEN
Journal of Chinese Physician 2002;0(S1):-
Objective To explore the diagnosis and surgical treatment of primary intestinal tumors, and improve the level of treatment. Methods Retrospective analysis of the clinical was made on the 68 cases of primary small intestinal tumors confirmed by pathological examination in our department in recent 20 years. HZ Results 34.8%(21/68) was benign tumors in 68 cases, and 69.1%(47/68) was malignancies. The common clinical prevsentations were abdominal pain (69.1%,47/68). gastrointestinal he morrhage (41.1%,28/68) and abdomen mass (13.2%,9/68). The preoperative misdiagnosis rate was 70.5%(48/68) .All the 68 cases performed operation, and no death. The 1 ,2 and 5 years survival rates of malignant tumors were 65.8%,42.1% and 29.3% respectively. Conclusions The clinical presertation of primary small intestinal tumor is non-spectific and the misdiagnosis rate is high. Kinds of diagnosis examinations should be done for the cases whose diagnosis are uncertain, and laboratory examinations should be considered if it is need. The main choice of treatment is surgery and the chemotherapy is necessary for malignant tumors also.
8.Treatment of lumbar disc herniation by prosthetic disc nucleus replacement
Qi CHEN ; Xiaotao WU ; Zubin MAO
Orthopedic Journal of China 2006;0(19):-
[Objective]To evaluate short term clinic results of prosthetic disc nucleus(PDN)replacement for the treatment of lumbar disc herniation.[Method]Twenty cases of lumbar disc herniation(including one case of recurrent lumbar disc herniation)were treated with PDN from June 2003 to November 2003,including 13 males and 7 females with average age of 40.5 years.All cases were implanted with a single PDN,in which 7 cases with PR725,8 cases with PW725,and 5 cases with PDN-SOLO-7 respectively.[Result]After surgery,one patient accepted the revision operation to remove the PDN because of device migration,the others experienced pain relief.The nineteen cases were followed-up for 23~29 months(mean 26.4 months).Compared with preoperative height of intervertebral disc,it gained increase of 17.2%(P
9.Ovarian insulin resistance and regulation of traditional Chinese medicine cryptotanshinone in mice
Jing CHEN ; Wei LI ; Qi WU ; Hongying KUANG ; Xiaoke WU
Journal of Medical Postgraduates 2015;(5):475-479
Objective The insulin pathways within ovary are in close relationship with female reproductive ability .The arti-cle was to observe the effects of ovarian insulin resistance on ovarian function and the effects of cryptotanshinone (CRY) on ovarian in-sulin resistance. Methods All mice were randomly divided into saline group (isotonic saline), DEX a group (isotonic saline plus DEX), CRY a group(isotonic saline plus DEX plus cryptotanshinone ), 10 in each group.The degree of insulin resistance was tested on each rat, along with the measurement of disintergrations per minute (DPM), ovulation rate and serum hormone level .After 20 fe-male mice were put to death , their ovaries were randomly divided into 4 groups:blank control group ( blank culture solution ) , DEX b group (DEX), CRY b group(DEX plus cryptotanshinone ), and WT group (DEX plus cryptotanshinone plus wortmannin ), 8 in each group. Murine ovaries in each group were cultured in vitro to test the number of ovarian glucose and the serum hormone level . Results After in-
sulin resistance took place in murine ovaries , significant statistical difference was found between DEX a group and saline group as to 2-deoxy-D-[1,2-3H]-glucose, liver, adipose and ovarian tissues (P<0.05).Ovaries in CRY a group increased significantly compared with DEX a group([2805.2 ±921.5]DMP/mg vs [1183.2 ±382.2]DMP/mg, P<0.01 ).Compared with DEX a group(37.5 ± 7.0, 5.0 ±1.8), the ovulation rate and the average corpus luteum in saline group (26.3 ±5.9, 3.5 ±1.6) and CRY group (27.2 ± 6.3,3.8 ±0.9) decreased (P<0.05).In comparison to DEX a group, the estrogen and progestogen levels in saline group and CRY a group decreased significantly(P<0.05).The expression level of AKT2 protein in DEX a group was much lower than that in saline group([0.39 ±0.01] vs [0.77 ±0.03], P<0.05).The glucose uptake in ovarian tissues cultured in vitro in blank control group , DEX b group, CRY b group and WT group was respectively (3447.2 ±1245.2)DMP/mg, (1183.2 ±382.2) DMP/mg, (2805.2 ± 921.5) DMP/mg, and (1364.2 ±292.3) DMP/mg.DEX b group decreased significantly compared with blank control group , DEX b group and WT group decreased significantly in comparison to CRY b group (P<0.05).In comparison to blank control group, the me-dium testosterone level increased and the protesteron level decreased significantly in DEX b group (P<0.05). Conclusion Tradi-tional Chinese medicine cryptotanshinone can relieve ovarian insulin resistance in vitro and in vivo , and it may exert insulin sensitivza-tion through PI3K pathway.
10.Study of β-defensin rBD-2 gene expression in the pulmonary tissues of the fetal, neonatal and adult rats
Hui ZHOU ; Ning HUANG ; Xinnian CHEN ; Qi WU ; Boyao WANG
Chinese Journal of Pathophysiology 2001;17(3):226-229
AIM: To investigate the developmental regulation of β-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P1: TTCAGTCATGAGGATCCATT AC; P2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS: Rat β-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION: The rat β-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that β-defensin-2 may play a role in the lung innate defense against infection.