ObjectiveTo investigate the association between immunoglobulin G （IgG）/immunoglobulin M （IgM） ratio and prognosis in patients with initially unresectable hepatocellular carcinoma （iuHCC） receiving TTP triple therapy with transcatheter arterial chemoembolization （TACE）， tyrosine kinase inhibitor （TKI）， and programmed cell death protein-1 （PD-1） inhibitors. MethodsA retrospective analysis was performed for the clinical data of 151 iuHCC patients who received TTP triple therapy in Department of Hepatobiliary Surgery， Guangxi Medical University Cancer Hospital， from November 2019 to December 2022， and according to IgG/IgM ratio， they were divided into high IgG/IgM group （IgG/IgM ratio >13.23） and low IgG/IgM group （IgG/IgM ratio ≤13.23）. The t-test was used for comparison of continuous data between groups， and the chi-square test was used for comparison of categorical data between groups. The Kaplan-Meier method and the log-rank test were used for survival analysis， and the Cox proportional hazards model was used to investigate the potential influencing factors for overall survival （OS）. ResultsThe 151 patients had a median OS of 26.7 months （95% confidence interval ［CI］： 19.8-not reached） and a median progression-free survival of 12.5 months （95%CI： 10.4 — 15.8）. The objective response rate was 83.4% and the disease control rate was 94.0%. There were no significant differences in baseline data between the high IgG/IgM group and the low IgG/IgM group （all P>0.05）. There was a significant difference in median OS between the high IgG/IgM group and the low IgG/IgM group （20.6 months vs not reached， P=0.016）. In both the high IgG/IgM group and the low IgG/IgM group， salvage hepatectomy was significantly associated with the improvement in OS （χ²=8.297 and 10.307， both P<0.05）. The multivariate analysis showed that high IgG/IgM ratio （hazard ratio ［HR］=1.799， 95%CI： 1.077 — 3.006， P=0.025）， baseline alpha-fetoprotein >400 ng/mL （HR=1.762， 95%CI： 1.017 — 3.050， P=0.043）， and BCLC stage （HR=2.265， 95%CI： 1.212 — 4.232， P=0.010） were independent influencing factors for OS. ConclusionHigh IgG/IgM ratio is associated with a poorer prognosis in iuHCC patients receiving TTP triple therapy， and salvage hepatectomy has a potential value in improving the prognosis of patients with a high IgG/IGM ratio.

Objective: To reveal the molecular biological mechanism of a rare Dc-variant individual using PacBio third-generation sequencing technology. Methods: ABO and Rh blood type identification, DAT, unexpected antibody screening and D antigen enhancement test were conducted by serological testing. The absorption-elution test was used to detect the e antigen. RHCE gene typing was performed by PCR-SSP, and the 1-10 exons of RHCE were sequenced by Sanger sequencing. The full-length sequences of RHCE, RHD and RHAG were detected by PacBio third-generation sequencing technology. Results: Serological findings: Blood type O, Dc-phenotype, DAT negative, unexpected antibody screening negative; enhanced D antigen expression; no detection of e antigen in the absorption-elution test. PCR-SSP genotyping indicated the presence of only the RHCE c allele. Sanger sequencing results: Exons 5-9 of RHCE were deleted, exon 1 had a heterozygous mutation at c. 48G/C, and exon 2 had five heterozygous mutations at c. 150C/T, c. 178C/A, c. 201A/G, c. 203A/G and c. 307C/T. Third-generation sequencing results: RHCE genotype was RHCE 02N. 08/RHCE-D(5-9)-CE; RHD genotype was RHD 01/RHD 01; RHAG genotype was RHAG 01/RHAG 01 (c. 808G>A and c. 861G>A). Conclusion: This Dc-individual carries the allele RHCE 02N. 08 and the novel allele RHCE-D(5-9)-CE. The findings of this study provide data support and a theoretical basis for elucidating the molecular mechanisms underlying RhCE deficiency phenotypes.

BACKGROUND: Preclinical studies have indicated that Angong Niuhuang Pills (ANP) reduce cerebral infarct and edema volumes. This study aimed to investigate whether ANP safely reduces cerebral infarct and edema volumes in patients with moderate to severe acute ischemic stroke. METHODS: This randomized, double-blind, placebo-controlled pilot trial included patients with acute ischemic stroke with National Institutes of Health Stroke Scale (NIHSS) scores ranging from 10 to 20 in 17 centers in China between April 2021 and July 2022. Patients were allocated within 36 h after onset via block randomization to receive ANP or placebo (3 g/day for 5 days). The primary outcomes were changes in cerebral infarct and edema volumes after 14 days of treatment. The primary safety outcome was severe adverse events (SAEs) for 90 days. RESULTS: There were 57 and 60 patients finally included in the ANP and placebo groups, respectively for modified intention-to-treat analysis. The median age was 66.0 years, and the median NIHSS score at baseline was 12.0. The changes in cerebral infarct volume at day 14 were 0.3 mL and 0.4 mL in the ANP and placebo groups, respectively (median difference: -7.1 mL; interquartile range [IQR]: -18.3 to 2.3 mL, P = 0.30). The changes in cerebral edema volume of the ANP and placebo groups on day 14 were 11.4 mL and 4.0 mL, respectively ( median difference: 3.0 mL, IQR: -1.3 to 9.9 mL, P = 0.15). The rates of SAE within 90 days were similar in the ANP (3/57, 5%) and placebo (7/60, 12%) groups ( P = 0.36). Changes in serum mercury and arsenic concentrations were comparable. In patients with large artery atherosclerosis, ANP reduced the cerebral infarct volume at 14 days (median difference: -12.3 mL; IQR: -27.7 to -0.3 mL, P = 0.03). CONCLUSIONS: ANP showed a similar safety profile to placebo and non-significant tendency to reduce cerebral infarct volume in patients with moderate-to-severe stroke. Further studies are warranted to assess the efficacy of ANP in reducing cerebral infarcts and improving clinical prognosis. TRAIL REGISTRATION Clinicaltrials.gov , No. NCT04475328.
Aged ; Female ; Humans ; Male ; Middle Aged ; Double-Blind Method ; Drugs, Chinese Herbal/adverse effects* ; Ischemic Stroke/drug therapy* ; Pilot Projects ; Stroke/drug therapy* ; Treatment Outcome

The medicinal materials of Bawei Chenxiang Pills(BCPs) were extracted via three methods: reflux extraction by water, reflux extraction by 70% ethanol, and extraction by pure water following reflux extraction by 70% ethanol, yielding three extracts of ST, CT, and CST. The efficacy of ST(760 mg·kg~(-1)), CT(620 mg·kg~(-1)), and CST(1 040 mg·kg~(-1)) were evaluated by acute myocardial ischemia(AMI) and p-chlorophenylalanine(PCPA)-induced insomnia in mice, respectively. Western blot was further utilized to investigate their hypnosis mechanisms. The main chemical components of different extracts were identified by the UPLC-Q-Exactive-MS technique. The results showed that CT and CST significantly increased the ejection fraction(EF) and fractional shortening(FS) of myocardial infarction mice, reduced left ventricular internal dimension at end-diastole(LVIDd) and left ventricular internal dimension at end-systole(LVIDs). In contrast, ST did not exhibit significant effects on these parameters. In the insomnia model, CT significantly reduced sleep latency and prolonged sleep duration, whereas ST only prolonged sleep duration without shortening sleep latency. CST showed no significant effects on either sleep latency or sleep duration. Additionally, both CT and ST upregulated glutamic acid decarboxylase 67(GAD67) protein expression in brain tissue. A total of 15 main chemical components were identified from CT, including 2-(2-phenylethyl) chromone and 6-methoxy-2-(2-phenylethyl) chromone. Six chemical components including chebulidic acid were identified from ST. The results suggested that chromones and terpenes were potential anti-myocardial ischemia drugs of BCPs, and tannin and phenolic acids were potential hypnosis drugs. This study enriches the pharmacological and chemical research of BCPs, providing a basis and reference for their secondary development, quality standard improvement, and clinical application.
Animals ; Drugs, Chinese Herbal/isolation & purification* ; Mice ; Male ; Sleep Initiation and Maintenance Disorders/physiopathology* ; Humans ; Myocardial Infarction/drug therapy* ; Myocardial Ischemia/drug therapy*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

This consensus will introduce the characteristics of fillers used in the surgical cavities of domestic nasal surgery patients based on relevant literature and expert opinions. It will also provide recommendations for the selection of cavity fillers for different nasal diseases, with chronic sinusitis as a representative example.
Humans ; Nasal Cavity/surgery* ; Nasal Surgical Procedures ; China ; Consensus ; Sinusitis/surgery* ; Dermal Fillers

OBJECTIVE: This study reports the first imported case of Lassa fever (LF) in China. Laboratory detection and molecular epidemiological analysis of the Lassa virus (LASV) from this case offer valuable insights for the prevention and control of LF. METHODS: Samples of cerebrospinal fluid (CSF), blood, urine, saliva, and environmental materials were collected from the patient and their close contacts for LASV nucleotide detection. Whole-genome sequencing was performed on positive samples to analyze the genetic characteristics of the virus. RESULTS: LASV was detected in the patient's CSF, blood, and urine, while all samples from close contacts and the environment tested negative. The virus belongs to the lineage IV strain and shares the highest homology with strains from Sierra Leone. The variability in the glycoprotein complex (GPC) among different strains ranged from 3.9% to 15.1%, higher than previously reported for the seven known lineages. Amino acid mutation analysis revealed multiple mutations within the GPC immunogenic epitopes, increasing strain diversity and potentially impacting immune response. CONCLUSION The case was confirmed through nucleotide detection, with no evidence of secondary transmission or viral spread. The LASV strain identified belongs to lineage IV, with broader GPC variability than previously reported. Mutations in the immune-related sites of GPC may affect immune responses, necessitating heightened vigilance regarding the virus.
Humans ; China/epidemiology* ; Genome, Viral ; Lassa Fever/virology* ; Lassa virus/classification* ; Molecular Epidemiology ; Phylogeny

Objective To investigate an automated pretreatment technology for detecting levels of free silica in workplace dust. Methods An fully automated pretreatment workstation for detecting free silica levels in workplace dust was developed by integrating graphite-controlled digestion temperature, online-controlled dilution of digestion solutions, and filtration endpoint recognition based on monitoring technology, combined with multi-channel synchronous measurements. Results The fully automatic pretreatment workstation was used to digest and filter 14 standard samples of free silica produced by three institutions, and then detected by pyrophosphate method. The result range of high-, medium-, and low-level free silica standard samples detection was 66.5%-84.8%, 40.0%-44.5%, and 2.1%-24.8%, respectively. The mean relative standard deviations were 3.9%, 1.4% and 1.5%. Conclusion The fully automated pretreatment workstation produced results that met relevant requirements. It can effectively replace the manual digestion and filtration steps of the pyrophosphate method to measure free silica levels in workplace dust and enable rapid detection of free silica in dust samples.