1.Dacryocystorhinostomy under endoscopy with mitomycin for chronic dacryocystitis
Qi-Ji, HUANG ; Liang-Xuan, CAI ; Ting-Wen, LIN
International Eye Science 2016;16(6):1190-1192
? AIM: To explore the curative effect of dacryocystorhinostomy under endoscopy with mitomycin for the treatment of chronic dacryocystitis.?METHODS: Totally 73 cases ( 78 eyes ) with chronic dacryocystitis were treated with dacryocystorhinostomy under endoscopy with mitomycin and followed up for 6-12mo.?RESULTS: In the 73 patients, 66 cases with 70 eyes (90%) were cured, 2 cases with 3 eyes (4%) improved, 5 cases with 5 eyes ( 6%) not changed. In the recurrent 5 eyes, 2 eyes were treated under endoscopy to remove granulation, enlarge the opening, then anesthetic tube was placed after cotton sheet with 0. 4g/L mitomycin was put on the incision for 5min. The rest 3 eyes were treated in superior hospital with laser, and all were successful. There was no severe complication observed.?CONCLUSION:Dacryocystorhinostomy under endoscopy with mitomycin for chronic dacryocystitis is effective.
2.Intervention effect of lecithin on cell membrane injury of African green monkey kidney exposed to sodium arsenite in vitro
Ting-ting, WANG ; Ya-lou, ZHANG ; Ji-wen, LIU ; Sheng-ling, WANG
Chinese Journal of Endemiology 2011;30(4):399-402
Objective To observe the lecithin's effect on membrane of African green monkey kidney cells (Vero) exposed to sodium arsenite(NaAsO2). Methods Vero cells cultured in vitro were divided into 4 groups:control group (saline), model group (2.20 mg/L NaAsO2), high eoncentration of lecithin and arsenic group (53.33mg/L lecithin + 2.20 mg/L NaAsO2), low eoncentration of lecithin and arsenic group( 13.32 mg/L lecithin + 2.20 mg/L NaAsO2), 6 bottles of cells in each group, medium was changed every 2 days, cultured for 120 h. Na+ ,K+-ATPase activities of membrane were measured by spectrophotometry, and membrane phospholipids composition including phosphatidylserine (PS), phosphatidylethano-lamine (PE), phosphatidylcholine (PC) and sphingmyelin (SM) were measured by high performance liquid chromatography (HPLC). Results The Na~, K+-ATPase activities of membrane of control group, model group, high concentration of lecithin and arsenic group, low concentration of lecithin and arsenic group were (0.962 ± 0.081) × 106, (0.544 ± 0.037) × 106, (0.647 ± 0.043) x 106, (0.550±Compared with control group, the Na+ ,K+-ATPase activities of other 3 groups were significantly reduced (all P < 0.05). Compared with model group, the Na+ ,K+-ATPase activity in high concentration of lecithin and arsenic group was significantly higher (P < 0.05),but in low concentration of lecithin and arsenic group did not change significantly (P > 0.05). Compared with control group[(0.087 ± 0.003), (0.127 ± 0.053), (0.588 ± 0.105),(0.071 ± 0.029)g/L], PS, PE, PC, SM levels in model group[(0.051 ± 0.018), (0.073 + 0.030), (0.240 ±0.038), (0.047 ± 0.121 )g/L] were significantly lower(all P < 0.05) ;PS, PE, PC in high concentration of lecithin and arsenic group[(0.084 ± 0.011), (0.109 ± 0.363), (0.591 ± 0.476)g/L] did not change significantly(all P > 0.05), but SM[(0.057 ± 0.004)g/L] significantly decreased(P < 0.05) ;PS, PE, SM levels of low concentration of lecithin and arsenic group[(0.058 ± 0.020), (0.086 ± 0.177), (0.048 ± 0.103)g/L] significantly reduced (all P < 0.05), the PC did not change significantly [(0.521±0.098 )g/L, P > 0.05]. Compared with model group,the levels of PS, PE, PC, SM in high concentration of lecithin and arsenic group were significantly higher(all P <0.05);PS, PE, SM levels in low concentration of lecithin and arsenic group did not change significantly(all P > 0.05), and PC was significantly higher(P < 0.05). Conclusions High concentration lecithin has certain protective effect on Vero cell membrane exposured to sodium arsenite.
3.Inhibitory effect of LZJ541, a novel small molecule inhibitor of STAT3, on the proliferation of hepatocellular carcinoma cells
Yi-chen LIU ; Ming JI ; Ting-ting DU ; Wen-qiang LIU ; Li LI ; Xiao-guang CHEN
Acta Pharmaceutica Sinica 2022;57(5):1396-1401
Signal transducer and activator of transcription 3 (STAT3) is an important regulatory factor of cell proliferation and metastasis, involved in the occurrence and development of a variety of malignant tumors, and it is one of the hot spots in the research of targeted anti-tumor drugs. Our group screened a novel benzobis (imidazole) structure small molecule compound LZJ541 through the screening model of Janus kinase (JAK)/STAT3 pathway inhibitors, which has definite STAT3 inhibitory activity. We examined the effect of LZJ541 on the proliferation of HepG2 and PC-3 cells by MTT assay
4.Efficacy of IL-21 monoclonal antibody on MRL/lprlupus mice.
Xu-E CHEN ; Ting MA ; Liang SHENG ; Wen-Wen WANG ; Ji LI
Chinese Journal of Applied Physiology 2021;37(5):467-470
5.JCS-based method on coordinate transformation of attachment points between muscle and bone
Gang TANG ; Wen-Ting JI ; Yuan-Chao LI ; Cheng-Tao WANG
Journal of Medical Biomechanics 2010;25(1):40-44
Objective In order to avoid potential injuries imposed to human body,it could be feasible to use the musculoskeletal models which can be reconstructed from the cadaver color cryosection(CCC)images,computerized tomography(CT)images,magnetic resonance(MR)images or other images to analyze the dynamic properties of muscles in vivo during human movement.Mothod We reconstruct the lower limb musculoskeletal model and define the uniform ioint coordinate system(JCS)on the model and the subject.The coordinate transformation of the muscle attachment points both on the model and the subject is described in detail.Results The length and the moment arm of the biceps femoris(short head)during knee flexion are calculated and analyzed.Conclusion This method plays an important role in improving the kinematics and dynamic simulation and the muscle force estimation.
6.JCS-based method on coordinate transformation of attachment points between muscle and bone
Gang TANG ; Wen-Ting JI ; Yuan-Chao LI ; Cheng-Tao WANG
Journal of Medical Biomechanics 2010;25(1):40-44
Objective In order to avoid potential injuries imposed to human body,it could be feasible to use the musculoskeletal models which can be reconstructed from the cadaver color cryosection(CCC)images,computerized tomography(CT)images,magnetic resonance(MR)images or other images to analyze the dynamic properties of muscles in vivo during human movement.Mothod We reconstruct the lower limb musculoskeletal model and define the uniform ioint coordinate system(JCS)on the model and the subject.The coordinate transformation of the muscle attachment points both on the model and the subject is described in detail.Results The length and the moment arm of the biceps femoris(short head)during knee flexion are calculated and analyzed.Conclusion This method plays an important role in improving the kinematics and dynamic simulation and the muscle force estimation.
7.Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis
Zhu JI-TING ; Lin HAN ; Wu XUAN ; Li ZHI-WEN ; Lin AI-YU
Chinese Medical Journal 2019;132(23):2827-2834
Background: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATITA-GAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOV A)in R software.Results: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each <1.41%).ITS genotype was 4efined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P = 0.0014)between infectious group and control group was observed.Conclusions: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.
8.A case with partial trisomy 7 (q34→qter) derived from a paternal reciprocal translocation t(7;14)(q34;q32).
Bing XIAO ; Xing JI ; Wen-ting JIANG ; Jing-min ZHANG ; Qin HU ; Jiong TAO
Chinese Journal of Medical Genetics 2011;28(6):654-657
OBJECTIVETo determine the origin of chromosomal aberrants in a mentally retarded children, and to correlate the karyotype with phenotype.
METHODSRoutine G-banding were performed to analyze the karyotype of the patient and her parents, and array comparative genomic hybridization (array CGH) were used for finely mapping the aberrant regions.
RESULTSThe mother had a normal karyotype. The father had an apparently balanced translocation involving chromosome 7q and 14q, the karyotype was 46, XX, t(7;14) (q34;q32), the karyotype of the child was then ascertained as 46, XX, der(14) t(7;14) (q34;q32.33) pat. Array CGH finely mapped the duplication to 7q34-qter, a 17.09 Mb region, and a very small associated deletion of distal chromosome 14 to 14q32.33-qter, a 2.27 Mb region. The patient presented some frequently seen features in partial trisomy 7q cases such as mental retardation, low birth weight, small nose, cleft palate, low-set ears and short neck.
CONCLUSIONThis result suggested that partial trisomy 7q exert mainly phenotypic effect on the patient. Parental karyotype analysis could help define the aberrant type.
Abnormalities, Multiple ; genetics ; Adult ; Child, Preschool ; Chromosome Banding ; Chromosomes, Human, Pair 14 ; Chromosomes, Human, Pair 7 ; genetics ; Comparative Genomic Hybridization ; Female ; Humans ; Intellectual Disability ; genetics ; Karyotyping ; Male ; Translocation, Genetic ; Trisomy ; genetics
9.A pilot study on spinal muscular atrophy carrier screening in Shanghai region using real-time PCR.
Xiao-xing QU ; Bing XIAO ; Xing JI ; Wen-ting JIANG ; Zu-jing YANG ; Jiong TAO
Chinese Journal of Medical Genetics 2013;30(1):1-4
OBJECTIVETo develop a screening program for spinal muscular atrophy (SMA) carriers, and to assess the carrier frequency and detection rate in Shanghai region.
METHODSQuantitative analysis of the SMN1 gene by real-time PCR was developed using specimens from 15 SMA patients and 76 SMA parents from 38 affected nuclear families. A pilot screening was carried out for 1741 asymptomatic pregnant women. Frequencies of SMN1 alleles were determined with the Hardy-Weinberg equilibrium.
RESULTSForty five out of the 1741 women were identified as SMA carriers by the presence of single copy of SMN1. The frequencies of no copy, 1 copy, 2 copy and 3 copy alleles were 1.37 U+00D7 10-2, 9.45 U+00D7 10-1, 2.80 U+00D7 10-2 and 1.27 U+00D7 10-2, respectively. The adjusted SMA carrier frequency was 1:35 with a detection rate of 94.49%. For those with a negative screening result, individuals with 3 copies carried a higher residual risk.
CONCLUSIONThe incidence of SMA carriers in Shanghai region is similar with that in Caucasian populations. Carrier screening has high detection efficiency. An effort should be made to further distinguish SMN1 gene copy numbers for those with more than 2 copies, since accurate determination of 2 and 3 copy allele frequencies is essential for post-screening genetic consulting.
Alleles ; Female ; Gene Dosage ; Gene Frequency ; Heterozygote ; Humans ; Male ; Muscular Atrophy, Spinal ; diagnosis ; genetics ; Pilot Projects ; Pregnancy ; Real-Time Polymerase Chain Reaction ; Survival of Motor Neuron 1 Protein ; genetics
10.Molecular and cytogenetic characterization of six 46, XX males due to translocations between the short arms of X and Y chromosomes.
Ya XING ; Xing JI ; Bing XIAO ; Wen-ting JIANG ; Qin HU ; Juan HU ; Ying CAO ; Jiong TAO
Chinese Journal of Medical Genetics 2012;29(4):408-412
OBJECTIVETo characterize molecular and cytogenetic abnormalities in six 46, XX males, and to investigate the clinical manifestations and underlying mechanisms in such patients.
METHODSClinical data of six XX male patients were collected. Karyotyping, multiple polymerase chain reaction (PCR) and fluorescence in situ hybridization (FISH) were utilized to detect and locate the sex determining region (SRY) gene.
RESULTSPCR and FISH showed that all patients were SRY-positive XX males. All patients have their SRY gene located at the tip of derivative X chromosomes, which have resulted from translocation between short arms of X and Y chromosomes. High resolution karyotyping at 550-750 band level has revealed that the translocation breakpoints were at Xp22.33 and Yp11.2 in three patients. In the remaining patients, the breakpoints were either at Xp22.32 and Yp11.31 or Xp22.31 and Yp11.2. The breakpoints at Xp22.32, Xp22.31 and Yp11.31 were rarely reported. Genotype-phenotype correlation analysis indicated that the clinical manifestations were age-specific. Four adult patients have come to clinical attention due to infertility, with typical features including azoospermia and testis dysgenesis, whereas poorly developed secondary sexual characteristics and short stature were main complaints of adolescence patients, and short stature was the sole symptom in a child patient.
CONCLUSIONCombined karyotyping, PCR and FISH are important for the analysis of XX males. Particularly, high resolution karyotyping is valuable for the refinement of chromosome breakpoints and detailed analysis of genotype-phenotype correlation.
46, XX Disorders of Sex Development ; genetics ; Adolescent ; Adult ; Child, Preschool ; Chromosomes, Human, X ; Chromosomes, Human, Y ; Genetic Association Studies ; methods ; Humans ; Karyotyping ; methods ; Male ; Sex Chromosome Aberrations ; Translocation, Genetic ; Young Adult