1.Dacryocystorhinostomy under endoscopy with mitomycin for chronic dacryocystitis
Qi-Ji, HUANG ; Liang-Xuan, CAI ; Ting-Wen, LIN
International Eye Science 2016;16(6):1190-1192
? AIM: To explore the curative effect of dacryocystorhinostomy under endoscopy with mitomycin for the treatment of chronic dacryocystitis.?METHODS: Totally 73 cases ( 78 eyes ) with chronic dacryocystitis were treated with dacryocystorhinostomy under endoscopy with mitomycin and followed up for 6-12mo.?RESULTS: In the 73 patients, 66 cases with 70 eyes (90%) were cured, 2 cases with 3 eyes (4%) improved, 5 cases with 5 eyes ( 6%) not changed. In the recurrent 5 eyes, 2 eyes were treated under endoscopy to remove granulation, enlarge the opening, then anesthetic tube was placed after cotton sheet with 0. 4g/L mitomycin was put on the incision for 5min. The rest 3 eyes were treated in superior hospital with laser, and all were successful. There was no severe complication observed.?CONCLUSION:Dacryocystorhinostomy under endoscopy with mitomycin for chronic dacryocystitis is effective.
2.Predictive Effect of Mean Platelet Volume in Patients with Portal Vein Thrombosis: A Meta-analysis of Case-control Studies
Wen-Yi LIN ; Xuan LU ; Feng-Juan FAN ; Yu HU
Journal of Huazhong University of Science and Technology (Medical Sciences) 2018;38(4):575-581
Mean platelet volume (MPV) is an early marker of platelet activation.Larger platelets,compared to small ones,increase platelet adhesion and aggregation,and present a higher thrombotic activity.Some studies have explored the association between MPV and the morbidity of portal vein thrombosis (PVT).The aim of this study was to evaluate the predictive effect of MPV in patients with PVT by a meta-analysis.We searched Pubmed,Web of Science,SCOPUS,OVID,CNKI and CBMD from database inception to September 13,2017.Seven studies in accordance with selection criteria were included.The extraction of basic data was independently conducted by two reviewers.The mean difference in MPV between PVT patients and controls were pooled with weighted mean difference (WMD)and 95% confidence interval of 0.88 fl (95% CI:0.61-1.15).A random-effect model was chosen for an obvious heterogeneity in the pooling (Chi-square=27.12,df=6,P<0.0001,I2=77.9%).The sources of heterogeneity were from the difference of primary disease of participants and portal vein diameter.Taken together,our results reveal that MPV is a predictive indicator in patients with PVT.
3.Analysis of the pollution status of paralytic shellfish poisons in shellfish sold in Hainan Province, 2018-2021
LI Cheng ; XIAO Wen-lin ; YE Hai-mei ; LAI Xuan-cheng ; SHI Hui ; HE Chang-hua
China Tropical Medicine 2023;23(5):484-
Abstract: Objective To investigate the pollution of paralytic shellfish poisons (PSP) in shellfish sold in Hainan Province from 2018 to 2021. Methods From 2018 to 2021, the content of 10 paralytic shellfish poisons including saxitoxin (STX), neosaxitoxin (neoSTX), gonyautoxins 1 (GTX1), gonyautoxins 2 (GTX2), gonyautoxins 3 (GTX3), gonyautoxins 4 (GTX4), gonyautoxins 5 (GTX5), decarbamoylsaxitoxin (dcSTX), decarbamoylgonyau toxins 2 (dcGTX2) and decarbamoylgonyau toxins 3 (dcGTX3) in 7 kinds of shellfish commonly sold in 13 cities and counties in Hainan province was analyzed. Results The detection rate of PSP in 360 shellfish samples was 10.3%. Among them, the highest detection rate of STX was 5.83%, followed by GTX2 detection rate of 4.17%; the detection rate of neoSTX and GTX3 were both 1.67%; the detection rate of GTX1 was 1.39%. None of the five PSP, GTX4, GTX5, dcSTX, dcGTX2 and dcGTX3, were detected. Four types of PSP were detected in fanscallops, two were detected in oysters, mussels and Scapharca subcrenata, only one was detected in scallops, and no toxin contamination was detected in clams and razor clams. A single sample of fanscallops detected a maximum of 4 PSP, and a single sample of oysters, scallops, mussels and Scapharca subcrenata detected a maximum of 1 PSP. The equivalence of PSP in all samples was ND-155.6 μg/kg.The annual detection rate of PSP from high to low was: 20.0% in 2020, 15.6% in 2019, 5.3% in 2018, and 2.0% in 2021, and none of the samples tested exceeded the standard. Continuously detectable STX in 2018-2020, all PSP that could be detected in 2018 were STX. In 2019, in addition to STX detected in scallops and Scapharca subcrenata, neoSTX was also detected in oysters, mussels and Scapharca subcrenata. In 2020, PSP was only detected from scallops, and GTX2 could be detected in all positive specimens, while 5 STX, 5 GTX1 and 6 GTX3 were detected. Only GTX2 detected from scallops in 2021. STX was detected in shellfish sold in 12 cities and counties, GTX2 can be detected in 10 cities and counties, neoSTX can be detected in 5 cities and counties, GTX1 and GTX2 were detected in 4 cities and counties respectively. Shellfish sold in Wenchang and Lingshui markets can detect 5 types of PSP. Conclusion Some types of shellfish on the market in Hainan are contaminated with some kind of PSP pollution risks, and it is necessary to strengthen the supervision of PSP in marketed shellfish.
4.An alkyne and two phenylpropanoid derivants from Carthamus tinctorius L.
Lin-qing QIAO ; Ge-ge XIA ; Ying-jie LI ; Wen-xuan ZHAO ; Yan-zhi WANG
Acta Pharmaceutica Sinica 2025;60(1):185-190
The chemical constituents from the
5.Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis
Zhu JI-TING ; Lin HAN ; Wu XUAN ; Li ZHI-WEN ; Lin AI-YU
Chinese Medical Journal 2019;132(23):2827-2834
Background: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATITA-GAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOV A)in R software.Results: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each <1.41%).ITS genotype was 4efined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P = 0.0014)between infectious group and control group was observed.Conclusions: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.
6.Treatment of hepatic cysts with dehydrated alcohol sclerosing agent guided by CT
Jian KONG ; Yong-Chong DOU ; Yan-Fang ZHANG ; Yu-Xuan WU ; Xin-Ying SHEN ; Zhen-Wen LIN ;
Journal of Interventional Radiology 2006;0(12):-
Objective To evaluate the clinical effects of CT guided percutaneous aspiration and sclerotherapy in treatment of hepatic cysts.Methods Sixty three patients with single(n=41)and muttiple(n= 22)hepatic cysts were undertaken CT guided pereutaneous aspiration and sclerotherapy with injection of absolute alcohol.Results Sixty three patients underwent follow-up for 3-15 months after the operation showing effective indexes as grade 0 for 4(6.39%),gradeⅠfor 8(12.69%),gradeⅡfor 23(36.51%)and gradeⅢfor 28(44.44%)cases.The total effective rate reached 93.61%.No serious complications occurred. Conclusion Sclerosing therapy with absolute alcohol is safe,economic,simple and effective for treating hepatic cysts.(J Intervent Radiol,2007,16:850-852)
7.Effects of dihydroxy-stilbene compound Vam3 on airway inflammation, expression of ICAM-1, activities of NF-kappaB and MMP-9 in asthmatic mice.
Li YANG ; Chunsuo YAO ; Zhiyuan WU ; Lingling XUAN ; Jinye BAI ; Guifang CHENG ; Mao LIN ; Mingchun WEN ; Qi HOU
Acta Pharmaceutica Sinica 2010;45(12):1503-8
The aim of the present study is to investigate the effects of Vam3 which is one of the dihydroxystilbene compounds on expressions of ICAM-1 in the lungs of OVA-induced asthmatic mice and the mechanisms of anti-airway inflammation. Balb/c mice were challenged with OVA inhalation. Lung tissues were stained with Mayer's hematoxylin and eosin for histopathologic examination. The expression of ICAM-1 in the lungs of mice was analyzed by Western blotting and immunohistochemistry method. The NF-kappaB activities were detected by NF-kappaB-luc reporter genetic transient transfection method. The activities of MMP-9 induced by LPS, TNF-alpha and PMA in THP-1 cells were determined by gelatin zymography method. The results showed that Vam3 could inhibit the expression of ICAM-1 in the OVA-induced mouse model. In addition, Vam3 could significantly suppress the activities of NF-kappaB in A549 cells and MMP-9 in THP-1 cells induced by LPS, TNF-alpha and PMA. These results suggested that Vam3 could alleviate the asthmatic inflammation by decreasing ICAM-1 expression in asthmatic mice, down regulating NF-kappaB and MMP-9 activities. Compound Vam3 showed inhibitory effects on inflammatory signal pathways involved in asthma.
8.Novel mechanisms of CTLA-4 inhibition on bone remodeling
Wen-Qiang MA ; Ya QIU ; Li-Zhong SUN ; Lin-Xuan WANG ; Mei HAN ; Fang-Lin MI
Chinese Journal of Immunology 2018;34(1):132-136
In recent years,the CTLA-4 immunoglobulin biologics,a negative regulator in the immune system,have been obtained due attention in autoimmune diseases,transplantation rejection,and antineoplastic agents.CTLA-4 can inhibit T cell activation,reduce the expression of RANKL and other cytokines through regulating immune response,and effectively alleviate the process of bone resorption.According to previous study,CTLA-4 was involved in osteoclast-induced bone destruction and bone remodeling.In this review,the effect of CTLA-4 on the autoimmune diseases,on the osteoclast formation,and on the alveolar bone remodeling in the periodontal tissue was involved,and the related research were also evaluated to look forward to possible future basic research and clinical application direction.
9.Study the Effects of Qianyang Yuyin Granules on Renal Blood Flow and Blood Pressures in Anesthetized Normal Dogs
Heng-Wen SONG ; Le SHI ; Zhu-Yuan FANG ; Xuan-Xuan ZHU ; Fang-Fang ZHU ; Yang SHEN ; Tai-Lin ZENG ; Li XU
Journal of Nanjing University of Traditional Chinese Medicine 2015;(2):143-146
OBJECTIVE To study the effects of Qianyang Yuyin Granules(QYG)on blood pressure and renal blood flow in anesthetized normal dogs and the mechanism of hypertensive renal injury treatment.METHODS The renal blood flow,cardiac output(CO)and blood pressures were determined by PowerLab system at 15,30,60,90,120,180 min after QYG(3.08,6. 15,12.30 g/kg)administration,respectively.RESULTS Compared with the control group,QYG(12.30 g/kg)reduced sys-tolic blood pressure(SBP) significantly(P<0.05) at 120 min and 180 min,and increased the renal blood flow(P<0.05~0.01)at 90,180 min;QYG(6.15 g/kg)reduced SBP(P<0.05)at 120 min,and increased the renal blood flow(P<0.05) at 90,120 min.The effects of QYG(3.08 g/kg) were not obvious;The three QYG groups hardly affected CO (P>0.05). CONCLUSION QYG can increase the renal blood flow,improve the renal function and then reduce blood pressure.
10.Morroniside inhibits H2O2-induced apoptosis in cultured nerve cells.
Hou-Xi AI ; Wen WANG ; Fang-Lin SUN ; Wen-Ting HUANG ; Yi AN ; Lin LI
China Journal of Chinese Materia Medica 2008;33(18):2109-2112
OBJECTIVETo investigate the effects of morroniside on H2O2-induced apoptosis in nerve cells.
METHODHuman neuroblastoma cell line SH-SY5Y cells were pre-incubaed with morroniside (1, 10, and 100 micromol x L(-1)) for 24 h prior to exposure to H2O2 (500 micromol x L(-1)) for 18 h. The activity of reactive SOD was measured by a biochemical assay. The expression of caspase-3, caspase-9, Bcl-2 and Bax was determined by Wastern blotting method.
RESULTPretreatment of the cells with morroniside (10 and 100 micromol x L(-1)) increasd SOD activity by 14% (P<0.01) and 11% (P<0.05) in comparison with cells exposed only to H2O2. Morroniside (1, 10, 100 micromol x L(-1)) lowered caspase-3 level by 31% (P<0.01), 103% (P<0.001) and 95% (P<0.001), decreased caspase-9 content by 71% (P<0.001), 132% (P<0.001) and 37% (P<0.05), and increasd Bcl-1 level by 88% (P<0.01), 121% (P<0.001) and 60% (P<0.01) respectively but no significant change occurred in Bax level in comparison with cells exposed only to H2O2.
CONCLUSIONMorroniside has neuroprotection effect against H2O2-induced oxidation injury in nerve cell.
Animals ; Apoptosis ; drug effects ; Blotting, Western ; Caspase 3 ; metabolism ; Caspase 9 ; metabolism ; Cell Line, Tumor ; Enzyme Activation ; drug effects ; Glycosides ; pharmacology ; Humans ; Hydrogen Peroxide ; pharmacology ; Mice ; Neurons ; cytology ; drug effects ; metabolism ; Oxidants ; pharmacology ; Proto-Oncogene Proteins c-bcl-2 ; metabolism ; Reverse Transcriptase Polymerase Chain Reaction ; Superoxide Dismutase ; metabolism