1.Dacryocystorhinostomy under endoscopy with mitomycin for chronic dacryocystitis
Qi-Ji, HUANG ; Liang-Xuan, CAI ; Ting-Wen, LIN
International Eye Science 2016;16(6):1190-1192
? AIM: To explore the curative effect of dacryocystorhinostomy under endoscopy with mitomycin for the treatment of chronic dacryocystitis.?METHODS: Totally 73 cases ( 78 eyes ) with chronic dacryocystitis were treated with dacryocystorhinostomy under endoscopy with mitomycin and followed up for 6-12mo.?RESULTS: In the 73 patients, 66 cases with 70 eyes (90%) were cured, 2 cases with 3 eyes (4%) improved, 5 cases with 5 eyes ( 6%) not changed. In the recurrent 5 eyes, 2 eyes were treated under endoscopy to remove granulation, enlarge the opening, then anesthetic tube was placed after cotton sheet with 0. 4g/L mitomycin was put on the incision for 5min. The rest 3 eyes were treated in superior hospital with laser, and all were successful. There was no severe complication observed.?CONCLUSION:Dacryocystorhinostomy under endoscopy with mitomycin for chronic dacryocystitis is effective.
2.Construction of Hexose Transporter-like HXT1 Deletion Mutant in Pichia pastoris
Wen-Wen ZHANG ; Ping ZHANG ; Yao-Ji XUAN ; Xiang-Shan ZHOU ; Yuan-Xing ZHANG ;
Microbiology 2008;0(09):-
Glucose was transported by the large number of hexose transporters in yeast cells. There were 18 hexose transporter genes had been identified in Saccharomyces cerevisiae. However,as an excellent expression system,there was no information of these genes had been reported in Pichia pastoris. Based on high homologous recombination efficiency in yeast,we chose G418 resistance for screening,200 bp were cloned from the up and down sequences of HXT1 ORF respectively,then ligated to the 5′ and 3′ end of G418 resis-tance gene for recombination. After electroporation of GS115 spheroplast and screened through different G418 concentration plates,finally we obtained one HXT1 gene deletion mutant named GS115?HXT1. The growth rate and glucose consumption of this mutant were both lower than the wide type.
4.Effects of Rebixiao granules on blood uric acid in patients with repeatedly attacking acute gouty arthritis.
Wei JI ; Xuan-xuan ZHU ; Wen-feng TAN ; Yan LU
Chinese journal of integrative medicine 2005;11(1):15-21
OBJECTIVETo observe the clinical effect of Rebixiao granule (RBXG) in treating repeatedly attacking acute gouty arthritis and through experimental study on blood uric acid to explore RBXG's therapeutic mechanism.
METHODSNinety repeatedly attacking acute gouty arthritis patients were divided into the treated group (n = 60) and control group (n = 30). The treated group was treated with RBXG, and the control group was treated with Futalin tablets (diclofenac sodium). The baseline treatment including good rest, low purine diet, sufficient water drinking and urine alkalization, etc. was then given to both groups. Hypoxanthine 600 mg/kg and niacin 100 mg/kg was applied to hyperuricemic mice by gastrogavage to establish the animal models.
RESULTSThe clinical effective rate of the treated group was 95.0% and that of the control 90.0%. Good therapeutic effects were won, insignificant difference (P > 0.05)was shown between the two groups. However, the cure rate of the treated group was 26.7% while that of the control group was 10.0%, with significant difference (P < 0.01) shown between them. The treated group had its blood uric acid lowered, which was significantly different (P < 0.05) from that of the control group. The animal experiment indicated that all the three groups treated with different dosages of RBXG, as well as the Ash bark and Smilax glabra rhizome groups had their blood uric acid content reduced in the hyperuricemic mice.
CONCLUSIONRBXG has a quicker initiation and better treatment effects than sole anti-inflammatory and analgesic agents on the treatment of repeatedly attacking acute gouty arthritis, showing no obvious toxic or adverse reactions and therefore good for long-term administration and likely to be a safe TCM preparation to control the symptoms and reduce the onsets of repeatedly attacking of acute gouty arthritis. The animal experiment shows that both the compound preparation and part of the single ingredients in the recipe have the function of reducing blood uric acid. However, the compound recipe has better therapeutic effects, proving to be superior to single drugs.
Acute Disease ; Adult ; Aged ; Animals ; Anti-Inflammatory Agents, Non-Steroidal ; therapeutic use ; Arthritis, Gouty ; blood ; drug therapy ; physiopathology ; Diclofenac ; therapeutic use ; Drugs, Chinese Herbal ; pharmacology ; therapeutic use ; Humans ; Hyperuricemia ; blood ; Male ; Mice ; Mice, Inbred ICR ; Middle Aged ; Recurrence ; Treatment Outcome ; Uric Acid ; blood
5.Synthesis and mass spectrometric analysis of aristolochic acid-deoxyguanosine adducts.
Wen-Xuan JI ; Mi-Xin LIU ; Cheng-Dui YANG ; Yi-Pu CHEN
Acta Pharmaceutica Sinica 2008;43(3):295-298
To synthesize aristolochic acid (AA)-2'-deoxyguanosine 5'-monophosphate (dGp) adducts in vitro and develop a novel method for the characterization of the adducts using multiple mass spectrometric techniques. AA was incubated with dGp in vitro using either enzymatic activation (by xanthine oxidase) or chemical activation (by zinc) to synthesize AA-dGp adducts, and the reaction conditions were optimized. Crude extracts were analyzed by techniques of liquid chromatography-electrospray ionization/tandem mass spectrometry (LC-MS/MS) and high accuracy mass data and isotope pattern of super high resolution Fourier transform-ion cyclotron resonance mass spectrometry (FT-ICRMS). The quasi-molecular ion peaks of the AA-dGp adducts were obtained in the negative ion mode. Analysis by electrospray ionization/tandem mass spectrometry (ESI-MS/MS) provided useful structural information about AA-dGp adducts. AA can bind covalently to the exocyclic amino group of deoxyguanosine to form AA-dGp adducts. MS analysis is a powerful tool to detect and identify AA-dGp adducts simply, rapidly and accurately.
Aristolochic Acids
;
chemical synthesis
;
chemistry
;
Chromatography, High Pressure Liquid
;
methods
;
DNA
;
chemistry
;
metabolism
;
DNA Adducts
;
chemical synthesis
;
Deoxyguanosine
;
chemistry
;
Tandem Mass Spectrometry
;
methods
6.Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis
Zhu JI-TING ; Lin HAN ; Wu XUAN ; Li ZHI-WEN ; Lin AI-YU
Chinese Medical Journal 2019;132(23):2827-2834
Background: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATITA-GAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOV A)in R software.Results: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each <1.41%).ITS genotype was 4efined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P = 0.0014)between infectious group and control group was observed.Conclusions: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.
8.Value of tumor markers series of hydrothorax in differential diagnosis of pleural effusion.
Yun-qiu LIU ; Hui-li ZHANG ; Wen-jing GAO ; Xuan LAN ; Bao-jun YUAN ; Ji-min ZOU
Chinese Journal of Industrial Hygiene and Occupational Diseases 2008;26(1):34-38
OBJECTIVETo investigate the clinical value of pleural effusion lung ProGRP, neuron specific enolase (NSE), cytokeratin fragment 19 (CYFRA21-1), carcino-embryonic antigen (CEA), carbohydrate antigen 153 (CA153), carbohydrate antigen 19 - 9 (CA19-9) in differential diagnosis and histological typing of malignant pleural effusion caused by lung cancer.
METHODSAll the 171 patients with malignant hydrothorax caused by lung cancer were from coal-mine area of Kailuan. They were divided into the small cell lung cancer (SCLC) group (n = 39), the adenocarcinoma group (n = 99) and the squamous cell carcinoma group (n = 37). The patients with benign pleural effusion served as the controls (n = 30). The diagnostic value of pleural effusion ProGRP, NSE, CYFRA21-1, CEA, CA153 and CA19-9 was compared for each group.
RESULTSYouden index and the accurate rate of pleural effusion ProGRP + NSE (sequence test) were the highest in the diagnosis of malignant hydrothorax caused by SCLC. CEA + CA153 + CA19-9 (sequence test) was the highest in the diagnosis of malignant hydrothorax caused by adenocarcinoma. CYFRA21-1 + CEA + CA153 (on parallel test) were the highest in the diagnosis of malignant hydrothorax caused by squamous cell carcinoma. The Yonden index and the accurate rate were the highest by the single detection of CYFRA21 (0.5514 and 0.6878), and by the combined detection of ProGRP + CYFRA21-1 + CEA (on parallel test) (0.7029 and 0.8878).
CONCLUSIONThe first pleural effusion tumor markers of malignant hydrothorax caused by the SCLC, adenocarcinoma of lung, and lung squamous cell carcinoma are ProGRP, CEA and CYFRA21-1, respectively. The best combinations of pleural effusion tumor marker in diagnosis of malignant hydrothorax caused by the SCLC, adenocarcinoma of lung, lung squamous cell carcinoma and lung cancer are the combined detection of ProGRP + NSE (sequence test), combined detection of CEA + CA153 + CA19-9 (sequence test), the combined detection of CYFRA21-1 + CEA + CA153 (on parallel test) and ProGRP + CYFRA21-1 + CEA (on parallel test), respectively.
Adult ; Aged ; Aged, 80 and over ; Antigens, Neoplasm ; analysis ; Biomarkers, Tumor ; analysis ; CA-19-9 Antigen ; analysis ; Diagnosis, Differential ; Female ; Humans ; Keratin-19 ; analysis ; Lung Neoplasms ; complications ; diagnosis ; Male ; Middle Aged ; Peptide Fragments ; analysis ; Pleural Effusion, Malignant ; diagnosis ; etiology ; Recombinant Proteins ; analysis
9.Antibacterial effect of niaoluqing oral liquid on clinical drug-resistant strains and different serotype strains of Ureaplasma urealyticum in vitro.
Yuan LU ; Da-Can CHEN ; Qiang LI ; Guo-Wei XUAN ; Bao-Jian FAN ; Ji-Wen ZHAO ; Ning WANG
National Journal of Andrology 2002;8(2):152-154
OBJECTIVESTo study the antibacterial effect of Niaoluqing Oral Liquid (NOL) on clinical drug-resistant strains and 14 serotype strains Ureaplasma Urealyticum (UU).
METHODSSixty-three clinical strains of UU were detected to determine their serology and antibiotic susceptibilities by the metabolic inhibition test (MIT). Mininum inhibitory concentration (MIC) was used to evaluate the sensitivity of NOL to different serotypes of UU. The sensitivity of NOL, erythromycin and tetracycline to 63 clinical strains of UU was also studied.
RESULTSIn 63 clinical strains of UU, the range of MIC to NOL was from 0.48 mg/ml to 15.63 mg/ml, MIC50 < or = 1.95 mg/ml, MIC90 < or = 3.91 mg/ml. Among them, 31 strains were resistant to tetracycline and 31 were resistant to erythromycin. No obvious correlation between the sensitivity of NOL to UU clinical strains and that of erythromycin and tetracycline to UU clinical strains (P > 0.05). Clinical strains of UU in this experiment contains all of its serotypes, also having a higher sensitivity to NOL (MIC < or = 3.91 mg/ml) except serology 1, 2, 3 and 11 (MIC > or = 7.81 mg/ml).
CONCLUSIONSNOL exerts a strong in vitro antibacterial effect on erythromycin-resistant and tetracycline-resistant clinical strains of UU. All kinds of serotype strains had a higher sensitivity to NOL, too. Chinese medicinal herbs are of momentous significance in the treatment of UU infection.
Anti-Bacterial Agents ; pharmacology ; Drugs, Chinese Herbal ; pharmacology ; Humans ; Microbial Sensitivity Tests ; Ureaplasma urealyticum ; drug effects ; isolation & purification
10.Investigation on occupational exposure to 5-fluorouracil in pharmacy intravenous admixture service of a hospital.
Yu-wen HUANG ; Nian-hua ZHANG ; Dong-mei TONG ; Xuan FENG ; Mei-bian ZHANG ; Ji-liang HE
Chinese Journal of Industrial Hygiene and Occupational Diseases 2010;28(6):414-417
OBJECTIVETo investigate the level of occupational exposure to 5-fluorouracil (5-Fu) in the pharmacy intravenous admixture service (PIVAS) of a hospital, and identify the sources of 5-Fu contamination.
METHODSThe 5-Fu concentrations in air, on the surface of different areas in PIVAS and personal protective equipments were detected using UV-vis spectrophotometry.
RESULTSThe 5-Fu in air could not be detected. The 5-Fu concentrations on five different surfaces of biological safety cabinets were (22.00 +/- 6.35), (13.99 +/- 2.46), (14.13 +/- 0.72), (7.25 +/- 1.19) and (9.87 +/- 1.23) ng/cm2, respectively, which were significantly higher than those [(3.14 +/- 0.04), (5.43 +/- 0.65), (2.26 +/- 0.17), (2.26 +/- 0.17) and (3.63 +/- 0.46) ng/cm2] of corresponding controls (P < 0.05 or P < 0.01). The 5-Fu concentrations of the floor under cabinets [(18.19 +/- 5.22) ng/cm2], the floor in front of cabinets [(10.25 +/- 2.57)ng/cm2], the office floor [(11.64 +/- 2.53) ng/cm2], the terrace floor [(99.89 +/- 14.06 ) ng/cm2], the floor beside trash can in dressing room [(24.54 +/- 0.23) ng/cm2] were significantly higher than those of control [(3.36 +/- 0.11 ) ng/cm2] (P < 0.05 or P < 0.01). The 5-Fu concentrations of the tables in preparation room [(7.22 +/- l.04) ng/cm2] and the tables in office [(11.81 +/- 1.18) ng/cm2] were significantly higher than those of control [(5.56 +/- 0.14) ng/cm2] (P < 0.05 or P < 0.01). The 5-Fu concentrations of the indoor handle in preparation room were significantly higher than those of controls (P < 0.05 or P < 0.01). 5-Fu concentrations on the surfaces of outdoor handle and floor beside door in preparation room were not significantly increased compared with controls (P > 0.05). The 5-Fu concentrations on the surfaces of infusion bags, transfer box, transfer trays were significantly higher than those of controls (P < 0.05). The differences of 5-Fu concentrations between outer and inner masks and controls were not significant (P > 0.05). The 5-Fu concentrations of gloves of preparing and checking staffs were significantly higher than those of controls (P < 0.05 or P < 0.01).
CONCLUSIONThe preparing and checking process of 5-Fu and the treatment of medical wastes are major sources of 5-Fu contamination.
Antineoplastic Agents ; analysis ; Drug Administration Routes ; Fluorouracil ; analysis ; Humans ; Occupational Exposure ; Pharmacy Service, Hospital