? AIM: To explore the curative effect of dacryocystorhinostomy under endoscopy with mitomycin for the treatment of chronic dacryocystitis.?METHODS: Totally 73 cases ( 78 eyes ) with chronic dacryocystitis were treated with dacryocystorhinostomy under endoscopy with mitomycin and followed up for 6-12mo.?RESULTS: In the 73 patients, 66 cases with 70 eyes (90%) were cured, 2 cases with 3 eyes (4%) improved, 5 cases with 5 eyes ( 6%) not changed. In the recurrent 5 eyes, 2 eyes were treated under endoscopy to remove granulation, enlarge the opening, then anesthetic tube was placed after cotton sheet with 0. 4g/L mitomycin was put on the incision for 5min. The rest 3 eyes were treated in superior hospital with laser, and all were successful. There was no severe complication observed.?CONCLUSION:Dacryocystorhinostomy under endoscopy with mitomycin for chronic dacryocystitis is effective.

Aim To investigate the mechanism of the inhibitory effect of apoptosis inducible factor p53 on the toxicity of glutamate in HT22 cell lines. Methods CCK-8 and PI/Hoechst fluorescence double staining were used to detect the survival rate of HT22 cells. Western blot was applied to determine the protein expression levels of p53 and xCT. DHE fluorescence staining technique was employed to detect the intracellular reactive oxygen species ( ROS), and BODIPY 581/591 Cll lipid peroxidation sensor was utilized to confirm intracellular lipid oxidant situation. FeRhoN-ox M-l fluorescent probe was used to assess intracellular ferrous ions. Results After 6 h treatment of 1 μmol • L-1 Tenovin-1, the protein expression levels of p53 obviously increased. After high expression of p53, treatment with Glu and erastin(ferroptosis inducer) for 8 h ( Glu-p53 , Era-p53 groups) , cell death rate decreased significantly, and the expression levels of xCT increased significantly, compared with only Glu and erastin treated groups ( Glu, Era groups ) . Intracelluar ROS levels, lipid oxidant situations, ferrous ions declined in Glu-p53 groups compared to those of Glu group. Conclusions p53 inhibits the neurotoxicity induced by Glu, which may be related to the inhibition of ferroptosis by regulating xCT expression.

Aim To investigate the mechanisms that propofol inhibits alcohol-induced liver injury in C57 mice. Methods HE and oil red staining methods were used to measure the injury and lipid accumulation rates in liver. Immunofluorescence (IF) was used to identify the colocalization rate of mitochondria and LC3. ALT and AST tests were used to identify the liver injury level. Molecular docking experiment was used to predict the target protein of propofol. Western blot and immunohistochemistry (IHC) experiments were used to detect SIRT2 protein level. Results Propofol could significantly attenuate alcohol-induced high ALT/AST level, lipid accumulation, and enhance mitophagy level. According to molecular docking and Western blot experiments, propofol had high correlation with SIRT2 protein, and propofol could rescue alcohol-induced low expression level of SIRT2 protein. In addition, sirReal2 (an inhibitor of SIRT2) could significantly inhibit the protective effects of propofol in mouse liver. Con-clusion Propofol could protect against alcohol-induced liver injury through SIRT2 protein to enhance mitophagy level.

Background: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATITA-GAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOV A)in R software.Results: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90％to 99.97％),followed by many other fungal groups(each ＜1.41％).ITS genotype was 4efined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P = 0.0014)between infectious group and control group was observed.Conclusions: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.

BACKGROUNDSpinal muscular atrophy (SMA) is an autosomal recessive disease characterized by degeneration of anterior horn cells of the spinal cord. The survival motor neuron gene is SMA-determining gene deleted in approximately 95% of SMA patients. This study was undertaken to predict prenatal SMA efficiently and rapidly in families with previously affected child.

METHODSPrenatal diagnosis was made in 8 fetuses with a family history of SMA. Polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) were used for the detection of the survival motor neuron gene.

RESULTSThe survival motor neuron gene was not found in 6 fetuses, ruling out the diagnosis of SMA. Two fetuses were detected positive and the pregnancies were terminated.

CONCLUSIONOur method is effective and convenient in prenatal diagnosis of SMA.

Adult ; Amniotic Fluid ; cytology ; Cyclic AMP Response Element-Binding Protein ; genetics ; Exons ; Female ; Fetal Blood ; cytology ; Humans ; Nerve Tissue Proteins ; genetics ; Polymerase Chain Reaction ; Pregnancy ; Prenatal Diagnosis ; methods ; RNA-Binding Proteins ; genetics ; SMN Complex Proteins ; Sequence Analysis, DNA ; Spinal Muscular Atrophies of Childhood ; diagnosis ; genetics

OBJECTIVETo investigate the effects of morroniside on H2O2-induced apoptosis in nerve cells.

METHODHuman neuroblastoma cell line SH-SY5Y cells were pre-incubaed with morroniside (1, 10, and 100 micromol x L(-1)) for 24 h prior to exposure to H2O2 (500 micromol x L(-1)) for 18 h. The activity of reactive SOD was measured by a biochemical assay. The expression of caspase-3, caspase-9, Bcl-2 and Bax was determined by Wastern blotting method.

RESULTPretreatment of the cells with morroniside (10 and 100 micromol x L(-1)) increasd SOD activity by 14% (P<0.01) and 11% (P<0.05) in comparison with cells exposed only to H2O2. Morroniside (1, 10, 100 micromol x L(-1)) lowered caspase-3 level by 31% (P<0.01), 103% (P<0.001) and 95% (P<0.001), decreased caspase-9 content by 71% (P<0.001), 132% (P<0.001) and 37% (P<0.05), and increasd Bcl-1 level by 88% (P<0.01), 121% (P<0.001) and 60% (P<0.01) respectively but no significant change occurred in Bax level in comparison with cells exposed only to H2O2.

CONCLUSIONMorroniside has neuroprotection effect against H2O2-induced oxidation injury in nerve cell.

Animals ; Apoptosis ; drug effects ; Blotting, Western ; Caspase 3 ; metabolism ; Caspase 9 ; metabolism ; Cell Line, Tumor ; Enzyme Activation ; drug effects ; Glycosides ; pharmacology ; Humans ; Hydrogen Peroxide ; pharmacology ; Mice ; Neurons ; cytology ; drug effects ; metabolism ; Oxidants ; pharmacology ; Proto-Oncogene Proteins c-bcl-2 ; metabolism ; Reverse Transcriptase Polymerase Chain Reaction ; Superoxide Dismutase ; metabolism

OBJECTIVETo investigate the effect of Helicobacter pylori (Hp) on platelet activation and coagulation function in patients with acute cerebral infarction.

METHODSSixty-six patients with acute cerebral infarction and 50 health individuals were enrolled in the study. Hp antibody,expression of CD62p on platelets and clotting indexes were measured and compared between two groups.

RESULTSThe positive rate of Hp-IgG and Hp-CagA in cerebral infarction patients were higher than that in controls (P<0.05). The positive rate of CD62p in patients with positive Hp-IgG and Hp-CagA was significantly higher than that in negative patients and also controls (P<0.05). The APTT and TT were lower and FIB was higher in patients with positive Hp antibody than those in patients with negative Hp antibody (P<0.05),but there was no difference in PT,PTR and INR (P>0.05).

CONCLUSIONHp infection can activate platelets and affect coagulation function,which may be involved in the development of cerebral infarction.

Adult ; Aged ; Antibodies, Bacterial ; blood ; Antigens, Bacterial ; metabolism ; Bacterial Proteins ; metabolism ; Blood Coagulation ; Case-Control Studies ; Cerebral Infarction ; blood ; microbiology ; Female ; Helicobacter Infections ; blood ; complications ; Helicobacter pylori ; metabolism ; pathogenicity ; Humans ; Immunoglobulin G ; blood ; Male ; Middle Aged ; P-Selectin ; blood ; Platelet Activation

Objective To study the changes of plasma normetanephrine(NMN) and metanephrine(MN) during the resection of adrenal pheochromocytoma. Methods Fourteen patients with adrenal pheocromocytoma and 9 patients with adrenal cortex tumor were recruited in our study. Blood samples were obtained at these time points: after anesthesia induction,the beginning of incision of skin, when exploring the tumor,resection of the tumor, and the end of anesthesia. The NMN and MN were determined by high performance liquid chromatogram (HPLC). Results NMN were obviously different among 5 time points in the patients with adrenal pheocromocytoma (P0.05). No significant difference was found between NMN and MN in the patients with adrenal cortex tumor. Conclusion NMN has markedly changed during the resection of adrenal pheochromocytoma, while MN has been relatively stable. The anesthesia induction and exploring of the tumor are the key of a successful operation. MN is the stable index in the diagnosis of adrenal pheochromocytoma.

Objective:To summarize the research on oral health education for pregnant women.Methods:The literature was described and analyzed using a scoping review method. Seven databases, such as PubMed, Embase, Web of Science, China National Knowledge Infrastructure, and WanFang Data, were electronically searched, and the search period was from database establishment to October 30, 2023.Results:A total of 43 articles were included. The implementers of health education were mainly dental professionals and prenatal healthcare personnel. The theoretical basis included the health belief model, planned behavior theory, social cognitive model and so on. The methods involved traditional teaching or lectures, family-centered, internet-based, and motivational interviews. The contents contained many aspects of oral health for pregnant women. The evaluation indicators mainly covered oral health knowledge, attitude and practice, and self-efficacy, oral health beliefs, oral health status, the incidence of oral diseases, adverse pregnancy outcomes of pregnant and postpartum women, and childhood caries incidence.Conclusions:We should establish a cooperation team of the Department of Stomatology and Obstetrics and Gynecology, incorporate oral health for pregnant women into prenatal care projects, fully utilize the platform of pregnant women's schools, explore the optimal theoretical basis for oral health education, and improve the content of oral health education for pregnant women.

Background and Objectives: Chronic inflammation of bone tissue often results in bone defects and hazards to tissue repair and regeneration. Cannabidiol (CBD) is a natural cannabinoid with multiple biological activities, including anti-inflammatory and osteogenic potential. This study aimed to investigate the efficacy and mechanisms of CBD in the promotion of bone marrow mesenchymal stem cells (BMSCs) osteogenic differentiation in the inflammatory microenvironment. Methods: and Results: BMSCs isolated from C57BL/6 mice, expressed stem cell characteristic surface markers and pre-sented multidirectional differentiation potential. The CCK-8 assay was applied to evaluate the effects of CBD on BMSCs’ vitality, and demonstrating the safety of CBD on BMSCs. Then, BMSCs were stimulated with lipopolysaccharide (LPS) to induce inflammatory microenvironment. We found that CBD intervention down-regulated mRNA expression levels of inflammatory cytokines and promoted cells proliferation in LPS-treated BMSCs, also reversed the protein and mRNA levels downregulation of osteogenic markers caused by LPS treatment. Moreover, CBD intervention activated the cannabinoid receptor 2 (CB2) and the p38 mitogen-activated protein kinase (MAPK) signaling pathway. While AM630, a selective CB2 inhibitor, reduced phosphorylated (p)-p38 levels. In addition, AM630 and SB530689, a selective p38 MAPK inhibitor, attenuated the enhancement of osteogenic markers expression levels by CBD in inflammatory microenvironment, respectively. Conclusions CBD promoted osteogenic differentiation of BMSCs via the CB2/p38 MAPK signaling pathway in the inflammatory microenvironment.