1.Dacryocystorhinostomy under endoscopy with mitomycin for chronic dacryocystitis
Qi-Ji, HUANG ; Liang-Xuan, CAI ; Ting-Wen, LIN
International Eye Science 2016;16(6):1190-1192
? AIM: To explore the curative effect of dacryocystorhinostomy under endoscopy with mitomycin for the treatment of chronic dacryocystitis.?METHODS: Totally 73 cases ( 78 eyes ) with chronic dacryocystitis were treated with dacryocystorhinostomy under endoscopy with mitomycin and followed up for 6-12mo.?RESULTS: In the 73 patients, 66 cases with 70 eyes (90%) were cured, 2 cases with 3 eyes (4%) improved, 5 cases with 5 eyes ( 6%) not changed. In the recurrent 5 eyes, 2 eyes were treated under endoscopy to remove granulation, enlarge the opening, then anesthetic tube was placed after cotton sheet with 0. 4g/L mitomycin was put on the incision for 5min. The rest 3 eyes were treated in superior hospital with laser, and all were successful. There was no severe complication observed.?CONCLUSION:Dacryocystorhinostomy under endoscopy with mitomycin for chronic dacryocystitis is effective.
2.Inhibitory effect of LZJ541, a novel small molecule inhibitor of STAT3, on the proliferation of hepatocellular carcinoma cells
Yi-chen LIU ; Ming JI ; Ting-ting DU ; Wen-qiang LIU ; Li LI ; Xiao-guang CHEN
Acta Pharmaceutica Sinica 2022;57(5):1396-1401
Signal transducer and activator of transcription 3 (STAT3) is an important regulatory factor of cell proliferation and metastasis, involved in the occurrence and development of a variety of malignant tumors, and it is one of the hot spots in the research of targeted anti-tumor drugs. Our group screened a novel benzobis (imidazole) structure small molecule compound LZJ541 through the screening model of Janus kinase (JAK)/STAT3 pathway inhibitors, which has definite STAT3 inhibitory activity. We examined the effect of LZJ541 on the proliferation of HepG2 and PC-3 cells by MTT assay
3.Intervention effect of lecithin on cell membrane injury of African green monkey kidney exposed to sodium arsenite in vitro
Ting-ting, WANG ; Ya-lou, ZHANG ; Ji-wen, LIU ; Sheng-ling, WANG
Chinese Journal of Endemiology 2011;30(4):399-402
Objective To observe the lecithin's effect on membrane of African green monkey kidney cells (Vero) exposed to sodium arsenite(NaAsO2). Methods Vero cells cultured in vitro were divided into 4 groups:control group (saline), model group (2.20 mg/L NaAsO2), high eoncentration of lecithin and arsenic group (53.33mg/L lecithin + 2.20 mg/L NaAsO2), low eoncentration of lecithin and arsenic group( 13.32 mg/L lecithin + 2.20 mg/L NaAsO2), 6 bottles of cells in each group, medium was changed every 2 days, cultured for 120 h. Na+ ,K+-ATPase activities of membrane were measured by spectrophotometry, and membrane phospholipids composition including phosphatidylserine (PS), phosphatidylethano-lamine (PE), phosphatidylcholine (PC) and sphingmyelin (SM) were measured by high performance liquid chromatography (HPLC). Results The Na~, K+-ATPase activities of membrane of control group, model group, high concentration of lecithin and arsenic group, low concentration of lecithin and arsenic group were (0.962 ± 0.081) × 106, (0.544 ± 0.037) × 106, (0.647 ± 0.043) x 106, (0.550±Compared with control group, the Na+ ,K+-ATPase activities of other 3 groups were significantly reduced (all P < 0.05). Compared with model group, the Na+ ,K+-ATPase activity in high concentration of lecithin and arsenic group was significantly higher (P < 0.05),but in low concentration of lecithin and arsenic group did not change significantly (P > 0.05). Compared with control group[(0.087 ± 0.003), (0.127 ± 0.053), (0.588 ± 0.105),(0.071 ± 0.029)g/L], PS, PE, PC, SM levels in model group[(0.051 ± 0.018), (0.073 + 0.030), (0.240 ±0.038), (0.047 ± 0.121 )g/L] were significantly lower(all P < 0.05) ;PS, PE, PC in high concentration of lecithin and arsenic group[(0.084 ± 0.011), (0.109 ± 0.363), (0.591 ± 0.476)g/L] did not change significantly(all P > 0.05), but SM[(0.057 ± 0.004)g/L] significantly decreased(P < 0.05) ;PS, PE, SM levels of low concentration of lecithin and arsenic group[(0.058 ± 0.020), (0.086 ± 0.177), (0.048 ± 0.103)g/L] significantly reduced (all P < 0.05), the PC did not change significantly [(0.521±0.098 )g/L, P > 0.05]. Compared with model group,the levels of PS, PE, PC, SM in high concentration of lecithin and arsenic group were significantly higher(all P <0.05);PS, PE, SM levels in low concentration of lecithin and arsenic group did not change significantly(all P > 0.05), and PC was significantly higher(P < 0.05). Conclusions High concentration lecithin has certain protective effect on Vero cell membrane exposured to sodium arsenite.
4.Efficacy of IL-21 monoclonal antibody on MRL/lprlupus mice.
Xu-E CHEN ; Ting MA ; Liang SHENG ; Wen-Wen WANG ; Ji LI
Chinese Journal of Applied Physiology 2021;37(5):467-470
5.JCS-based method on coordinate transformation of attachment points between muscle and bone
Gang TANG ; Wen-Ting JI ; Yuan-Chao LI ; Cheng-Tao WANG
Journal of Medical Biomechanics 2010;25(1):40-44
Objective In order to avoid potential injuries imposed to human body,it could be feasible to use the musculoskeletal models which can be reconstructed from the cadaver color cryosection(CCC)images,computerized tomography(CT)images,magnetic resonance(MR)images or other images to analyze the dynamic properties of muscles in vivo during human movement.Mothod We reconstruct the lower limb musculoskeletal model and define the uniform ioint coordinate system(JCS)on the model and the subject.The coordinate transformation of the muscle attachment points both on the model and the subject is described in detail.Results The length and the moment arm of the biceps femoris(short head)during knee flexion are calculated and analyzed.Conclusion This method plays an important role in improving the kinematics and dynamic simulation and the muscle force estimation.
6.JCS-based method on coordinate transformation of attachment points between muscle and bone
Gang TANG ; Wen-Ting JI ; Yuan-Chao LI ; Cheng-Tao WANG
Journal of Medical Biomechanics 2010;25(1):40-44
Objective In order to avoid potential injuries imposed to human body,it could be feasible to use the musculoskeletal models which can be reconstructed from the cadaver color cryosection(CCC)images,computerized tomography(CT)images,magnetic resonance(MR)images or other images to analyze the dynamic properties of muscles in vivo during human movement.Mothod We reconstruct the lower limb musculoskeletal model and define the uniform ioint coordinate system(JCS)on the model and the subject.The coordinate transformation of the muscle attachment points both on the model and the subject is described in detail.Results The length and the moment arm of the biceps femoris(short head)during knee flexion are calculated and analyzed.Conclusion This method plays an important role in improving the kinematics and dynamic simulation and the muscle force estimation.
7.Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis
Zhu JI-TING ; Lin HAN ; Wu XUAN ; Li ZHI-WEN ; Lin AI-YU
Chinese Medical Journal 2019;132(23):2827-2834
Background: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATITA-GAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOV A)in R software.Results: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each <1.41%).ITS genotype was 4efined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P = 0.0014)between infectious group and control group was observed.Conclusions: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.
8.Effect of Triptolide on TNFalpha-induced activation of NF-kappaB and expression of COX-2 and iNOS in human rheumatoid arthritis synovial fibroblasts.
Xue-ting SHAO ; Lei FENG ; Hang-ping YAO ; Wen-ji SUN ; Li-huang ZHANG
Journal of Zhejiang University. Medical sciences 2004;33(2):160-165
OBJECTIVETo explore the effects of Triptolide (TP) on TNFalpha-induced cell proliferation and expressions of cyclooxygenase-2 (COX-2), inducible nitric oxide synthase (iNOS) and their inducing products PGE2, NO in human rheumatoid arthritis synovial fibroblasts (RASF).
METHODSFibroblasts (RASF) were obtained from synovial tissue of patients with RA and were cultured in vitro. RASF were stimulated with TNFalpha(20 microg/L) in the presence or absence of TP(0 - 100 microg/L) for 20 h. The RASF proliferation was determined by (3)H-TdR incorporation, and the productions of PGE2 and NO in culture supernatants of RASF were detected with competitive ELISA and enzyme reduction of nitrate. Expressions of COX-2 and iNOS mRNA in RASF were analyzed by semi-quantitative RT-PCR. Expressions of COX-2 and iNOS protein were estimated by Western-blot method and cellular enzyme immunoassay in synovial fibroblasts. NF-kappaB activity in whole-cell extract of RASF was also measured by an ELISA-based method.
RESULTSTP (>20 microg/L) down-regulated markedly TNFalpha-induced COX-2 and iNOS mRNA and protein expression, and their inducing products PGE2 and NO of synovial fibroblasts. This effect was positively correlated with TP concentrations. NF-kappaB activity in TNFalpha-stimulated synovial cells was suppressed profoundly by TP treatment (IC(50) approximately 35microg/L). The activity of NF-kappaB was correlated with the levels of COX-2 and iNOS expression in TNFalpha-stimulated RASF. No change was observed in proliferation of synovial cells after treatment of TP.
CONCLUSIONTP could significantly down-regulate TNFalpha-induced COX-2, iNOS expression and production of PGE2, NO in human RASF, which is associated with the suppression of NF-kappaB activity.
Arthritis, Rheumatoid ; drug therapy ; metabolism ; Cyclooxygenase 2 ; Diterpenes ; pharmacology ; Epoxy Compounds ; Fibroblasts ; metabolism ; Gene Expression Regulation ; drug effects ; Humans ; Isoenzymes ; analysis ; genetics ; Membrane Proteins ; NF-kappa B ; metabolism ; Nitric Oxide Synthase ; analysis ; genetics ; Nitric Oxide Synthase Type II ; Phenanthrenes ; pharmacology ; Prostaglandin-Endoperoxide Synthases ; analysis ; genetics ; RNA, Messenger ; analysis ; Synovial Membrane ; cytology ; metabolism ; Tumor Necrosis Factor-alpha ; pharmacology
9.A case with partial trisomy 7 (q34→qter) derived from a paternal reciprocal translocation t(7;14)(q34;q32).
Bing XIAO ; Xing JI ; Wen-ting JIANG ; Jing-min ZHANG ; Qin HU ; Jiong TAO
Chinese Journal of Medical Genetics 2011;28(6):654-657
OBJECTIVETo determine the origin of chromosomal aberrants in a mentally retarded children, and to correlate the karyotype with phenotype.
METHODSRoutine G-banding were performed to analyze the karyotype of the patient and her parents, and array comparative genomic hybridization (array CGH) were used for finely mapping the aberrant regions.
RESULTSThe mother had a normal karyotype. The father had an apparently balanced translocation involving chromosome 7q and 14q, the karyotype was 46, XX, t(7;14) (q34;q32), the karyotype of the child was then ascertained as 46, XX, der(14) t(7;14) (q34;q32.33) pat. Array CGH finely mapped the duplication to 7q34-qter, a 17.09 Mb region, and a very small associated deletion of distal chromosome 14 to 14q32.33-qter, a 2.27 Mb region. The patient presented some frequently seen features in partial trisomy 7q cases such as mental retardation, low birth weight, small nose, cleft palate, low-set ears and short neck.
CONCLUSIONThis result suggested that partial trisomy 7q exert mainly phenotypic effect on the patient. Parental karyotype analysis could help define the aberrant type.
Abnormalities, Multiple ; genetics ; Adult ; Child, Preschool ; Chromosome Banding ; Chromosomes, Human, Pair 14 ; Chromosomes, Human, Pair 7 ; genetics ; Comparative Genomic Hybridization ; Female ; Humans ; Intellectual Disability ; genetics ; Karyotyping ; Male ; Translocation, Genetic ; Trisomy ; genetics
10.Thrombin promotes epithelial ovarian cancer cell invasion by inducing epithelial-mesenchymal transition.
Yi Cun ZHONG ; Ting ZHANG ; Wen DI ; Wei Ping LI
Journal of Gynecologic Oncology 2013;24(3):265-272
OBJECTIVE: Over-expression of thrombin in ovarian cancer cells is associated with poor prognosis. In this study, we investigated the role of thrombin in inducing epithelial-mesenchymal transition (EMT) in SKOV3 epithelial ovarian cancer cells. METHODS: After thrombin treatment SKOV3 cells were subjected to western blots, reverse-transcription PCR, and enzyme-linked immunosorbent assay to quantify EMT-related proteins, mRNA expression of SMAD2, DKK1, and sFRP1, and the secretion of matrix metalloproteinases (MMPs) and cytokines. Meanwhile, invasion ability was evaluated using transwell assays. RESULTS: The results indicated a dose- and time-dependent down-regulation of E-cadherin and upregulation of N-cadherin and vimentin in thrombin-treated SKOV3 cells, compared with the thrombin-free control group (p<0.05). There was a dose- and time-dependent increase in the levels of SMAD2 and DKK1 mRNAs and a decrease in the levels of sFRP1 mRNA in thrombin-treated SKOV3 cells compared to control cells (p<0.05). Thrombin-treated SKOV3 cells exhibited increased secretion of MMP-9, MMP-2, interleukin (IL)-8, and IL-6 and increased invasion compared to untreated cells (p<0.05). Thrombin altered the morphology of SKOV3 cells to a spindle-like phenotype. Addition of hirudin to thrombin-treated cells reversed the effects of thrombin. CONCLUSION: Thrombin induced EMT and promoted the invasion of SKOV3 cells, possibly via distinct signaling pathways. Hirudin inhibited the effects of thrombin, suggesting that anticoagulant therapy could be a novel therapeutic strategy for ovarian carcinoma.
Blotting, Western
;
Cadherins
;
Cytokines
;
Down-Regulation
;
Enzyme-Linked Immunosorbent Assay
;
Epithelial-Mesenchymal Transition
;
Hirudins
;
Interleukin-6
;
Interleukins
;
Matrix Metalloproteinases
;
Neoplasms, Glandular and Epithelial
;
Ovarian Neoplasms
;
Phenotype
;
Polymerase Chain Reaction
;
Prognosis
;
Proteins
;
RNA, Messenger
;
Thrombin
;
Up-Regulation
;
Vimentin