Objective: To evaluate the clinical efficacy of sinew-regulating bone-setting manipulations plus exercise therapy in treating chronic non-specific low back pain (CNLBP). Methods: A total of 65 CNLBP patients were divided into two groups by the random number table method. Thirty-three cases in the treatment group were intervened by sinew-regulating bone-setting manipulations plus exercise therapy; 32 cases in the control group were intervened by medium-frequency electrotherapy plus exercise therapy. Before and after treatment, visual analog scale (VAS), dynamic and static muscle endurance of low back, median frequency (MF) of surface electromyography (sEMG) and Oswestry disability index (ODI) were used to evaluate the low back function. The therapeutic efficacy was estimated after treatment. Results: The two groups each had 2 dropouts during the study. The total effective rate was 90.3％ in the treatment group versus 66.7％ in the control group, and the between-group difference was statistically significant (P<0.05). After treatment, the VAS score, dynamic and static muscle endurance of low back, MF of sEMG and ODI score all changed significantly in both groups (all P<0.05); all the items in the treatment group were significantly different from those in the control group (all P<0.05). Conclusion: Sinew-regulating bone-setting manipulations plus exercise therapy can effectively release pain in CNLBP patients, increase muscle endurance of the low back and improve the quality of life, and its therapeutic efficacy is more significant than that of medium-frequency electrotherapy plus exercise therapy.

Objective To investigate the blood pressure status of preschool children in urban areas of Qingdao, and to determine the relationship between obesity and blood pressure in preschool children. Methods A stratified cluster sampling method was used to select a total of 13 kindergartens in urban districts of Qingdao. Height, weight, waist circumference, hip circumference and blood pressure of children in three classes were measured. Body mass index (BMI), waist to hip ratio and waist to height ratio were calculated and the relationship between obesity and blood pressure was analyzed. Results The mean values of systolic and diastolic blood pressure in preschool children in urban areas of Qingdao were (95.52±7.66) and (62.78±6.52) mmHg, respectively.The detection rate of hypertension in preschool children was 13.50%. The SBP and DBP were positively correlated with BMI, waist circumference, hip circumference and waist to height ratio. There was a linear regression relationship between body mass index and age and blood pressure. The risk of hypertension in overweight and obese children was 5.191 and 2.824 times of normal body weight, respectively. Conclusions The prevalence of hypertension in preschool children in Qingdao urban areas is high.Overweight and obesity are risk factors for elevated blood pressure.Therefore, while preventing preschool children from obesity, preschool children's blood pressure monitoring and blood pressure monitoring and early intervention of hypertension of preschool children should be implemented.

The purpose of our present work was to study the discharge of bursting-firing neurons (BFNs) in ipsilateral or contralateral hippocampus (HPC), and its relations to the reestablishment of local epileptic networks. The experiments were performed on 140 Sprague Dawley male rats (150-250 g). Acute tetanization (60 Hz, 2 s, 0.4 -0.6 mA) of the right posterior dorsal hippocampus (ATPDH) was administered to establish rat epilepsy model. The single unit discharges and the depth electrographs were simultaneously recorded from ipsilateral or contralateral HPC. In other experimental rats, acute tetanization of the right anterior dorsal HPC (ATADH) was used. Extracellular unit discharges in the CA1 region were simultaneously recorded from bilateral anterior dorsal hippocampi. Analysis of hippocampal BFN firing patterns before or after administration of the tetanization was focused on according to their location in the HPC epileptic networks in vivo. Single unit discharges of 138 hippocampal neurons were recorded from ipsilateral and/or contralateral anterior dorsal HPC. Of the 138 neurons recorded, 19 were BFNs. 13 BFNs were tetanus-evoked and the remaining 6 were spontaneous ones. The evoked reactions of the single hippocampal neuron induced by the tetanization mainly included: (1) the firing patterns of the BFNs in ipsilateral anterior dorsal HPC were obviously modulated by the ATPDH from tonic firing into rhythmic bursting. The bursting interspike intervals (BISI) decreased. (2) There were mild modulations of the firing patterns of the BFNs in contralateral anterior dorsal HPC following post-inhibition of the firing rate of single neuron induced by the ATPDH. The interspike intervals (ISI) increased obviously. (3) Post-facilitation of rhythmic bursting-firing of the BFNs in contralateral anterior dorsal HPC was induced by ATADH; both the ISI and the IBI increased. (4) Synchronous or asynchronous rhythmic bursting-firing of the BFNs and the network epileptiform events ipsilateral or contralateral anterior dorsal HPC were elicited by the ATPDH. The results obtained suggest that bursting-firing of single BFNs is produced by the ATPDH in the anterior dorsal HPC along the longitudinal axis of the ipsilateral HPC or across the hemisphere to the opposite HPC. Rhythmic activities of the BFN may be implicated in the epileptic network reestablishment of the HPC. On the other hand, synaptic modulation of the BFN temporal series might be responsible for pathophysiological information transmission in the HPC-epileptic network.
Animals ; Electric Stimulation ; Electrophysiology ; Epilepsy, Temporal Lobe ; physiopathology ; Evoked Potentials ; Hippocampus ; physiopathology ; Male ; Nerve Net ; physiopathology ; Neurons ; physiology ; Rats ; Rats, Sprague-Dawley ; Synaptic Transmission

The purpose of the present work was to study the role of unilateral hippocampal neural network in hippocampal epileptogenesis and its cellular mechanisms. Experiments were performed on 45 Sprague-Dawley adult rats. Acute tetanization (60 Hz, 2 s, 0.4 - 0.6 mA) of the right posterior dorsal hippocampus (ATPDH) was used to induce hippocampal epilepsy. The single unit discharges and the depth electrographs were synchronously recorded with a glass microelectrode and a pair of stainless concentric electrodes in the ipsilateral anterior dorsal hippocampus (HPC). The results demonstrated that: (1) some primary unit after-discharges were synchronized with electrographic after-discharges in the anterior dorsal HPC network after eight or nine tetanic trains were administered. Others desynchronized with 5 - 90 Hz primary depth electrographic after-discharges; (2) primary electrographic after-discharges were driven by primary unit after-discharges in the anterior dorsal HPC; (3) primary unit after-discharges were induced by brief primary electrographic after-discharges; and (4) plasticity of primary electrographic after-discharges and inhibition of single neuron firing were induced by repetitive ATPDH. The results suggest that hippocampal pathophysiologic network along the temporal-septal axis of the HPC is re-established by the repetitive ATPDH. There are plastic interactions between single neurons and its network during this re-establishment, which may be involved in the generation of "seizure oscillation". Over-activation of an intrinsic inhibition of the HPC along its temporal-septal axis might be involved in hippocampal network epileptogenesis.
Animals ; Electric Stimulation ; Epilepsy, Temporal Lobe ; physiopathology ; Evoked Potentials ; Hippocampus ; physiopathology ; Male ; Nerve Net ; physiopathology ; Neurons ; physiology ; Rats ; Rats, Sprague-Dawley

Background: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATITA-GAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOV A)in R software.Results: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90％to 99.97％),followed by many other fungal groups(each ＜1.41％).ITS genotype was 4efined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P = 0.0014)between infectious group and control group was observed.Conclusions: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.

Objective To analyse the epidemiological and clinical characteristics of different pathogenesis type cases,severe and common cages of hand,foot and mouth disease.Methods Deseriptive epidemic method Was used to analyse the epidemiological and clinical characteristics of labomtory-confirmed cases with hand,foot and mouth disease.Results The epidemiological characteristics 113 cages were the same as epidemic situation at the same time in Anji county.Clinical characteristics were difference in different pathogenesis type cases,severe and common cases of hand,foot and mouth disease.Conclusion Prevention and control work taken should according to the characteristics of the disease,such as early identification of severe cages,handling and controlling over the outbreaks in order to reduce the severe cases and the death.

BACKGROUNDThe adjunction of ultrasound to nerve stimulation has been proven to improve single-injection peripheral nerve block quality. However, few reports have been published determining whether ultrasound can facilitate continuous nerve blocks. In this study, we tested the hypothesis that the addition of ultrasound to nerve stimulation facilitates femoral nerve blocks with a stimulating catheter.

METHODSIn this prospective randomized study, patients receiving continuous femoral nerve blocks for total knee replacement were randomly assigned to either the ultrasound guidance combined with stimulating catheter group (USNS group; n = 60) or the stimulating catheter alone group (NS group; n = 60). The primary end point was the procedure time (defined as the time from first needle contact with the skin until correct catheter placement). The numbers of needle passes and catheter insertions, onset and quality of femoral nerve blocks, postoperative pain score, and early knee function were also recorded.

RESULTSThe procedure time was significantly less in the USNS group than in the NS group (9.0 (6.0 - 22.8) minutes vs. 13.5 (6.0 - 35.9) minutes, P = 0.024). The numbers of needle passes and catheter insertions were also significantly less in the USNS group. A greater complete block rate was achieved at 30 minutes in the USNS group (63.3% vs. 38.3%; P = 0.010). The postoperative pain score, the number of patients who required bolus local anesthetic and intravenous patient-controlled analgesia, and knee flexion on the second postoperative day were not significantly different between the two groups of patients.

CONCLUSIONSUltrasound-assisted placement of a stimulating catheter for femoral nerve blocks decreases the time necessary to perform the block compared with just the nerve-stimulating technique. In addition, a more complete blockade is achieved using the ultrasound-assisted technique.

Aged ; Aged, 80 and over ; Catheterization ; methods ; Female ; Femoral Nerve ; diagnostic imaging ; Humans ; Male ; Middle Aged ; Nerve Block ; instrumentation ; methods ; Ultrasonography

The purpose of this work was to study the characteristics of rat brain abnormalities at two hemispheres at the early stage of electrogenic epilepsy. Experiments were performed on 37 male Sprague-Dawley rats. Chronically repetitive tetanization (60 Hz, 2 s, 0.4 - 0.6 mA) was used to stimulate the right dorsal hippocampus (DHPC) of the rat brain once a day for 2, 4, 6, 8 or 10 d, respectively. The T(2) weighted magnetic resonance image (T(2)-WI) were obtained from each experimental rat at the end of the experiments. Histological sections were obtained after experimentation. The results showed that the main pathologic changes at the early stage of epilepsy included: (1) T(2)-WI hyperintensification, the histological enlargement of lateral ventricle (LV) and pathological hyperplasia of ventricular choroidea plexus occurred. The pathological hyperplasia was symmetric in two hemispheres, but the LV enlargement was not. (2) Histologically enlarged LV area showed a resemblance to T(2)-WI hyperintensive area. Compared with the control rats, large T(2)-WI hyperintensive area (P=0.0259; P=0.0184; P=0.0184; P=0.0404; P=0.0259) and histologically enlarged LV area (P=0.0210; P=0.01; P=0.0100; P=0.0152) were present in chronically tetanized rats. (3) Dynamic characteristics of histologically enlarged LV area resembled to those of T(2)-WI hyperintensity area in chronically tetanized rats at different stimulating day. Lateralization of T(2)-WI hyperintensity was in accordance with that of T(2)-WI abnormal area and of histologically enlarged LV. These abnormalities were severe on the contralateral side on the stimulating day 6, or on the ipsilateral side on the stimulating day 10. These results imply characteristic propagation of brain abnormalities crossing to the opposite hemisphere at the early stage of an electrogenic rat epilepsy.
Animals ; Cerebral Cortex ; pathology ; physiopathology ; Electric Stimulation ; Epilepsy ; etiology ; pathology ; physiopathology ; Hippocampus ; physiopathology ; Magnetic Resonance Imaging ; Male ; Rats ; Rats, Sprague-Dawley ; Time Factors

The severe fever with thrombocytopenia syndrome virus (SFTSV) is the causative pathogen of an emerging infectious disease severe fever with thrombocytopenia syndrome and a new member in the genus Phlebovirus of family Bunyaviridae. Immune responses and pathological lesions in SFTSV-infected Balb/C mice and hamsters were evaluated by inoculation of SFTSV at 105 TCID50 or 103 TCID50 per animal through four different routes of infection, including intravenous, intramuscular, intraperitoneal, and intracerebral injections. The vehicle control groups were also included. At different time points after the inoculation blood and plasma samples were collected. Blood cell counts, blood viral RNA copies, and plasma antibodies were detected by automatic blood cell counters, real-time PCR, and luminex assays, respectively. At two weeks post inoculation, the animals were sacrificed. Tissues including heart, liver, spleen, lung, kidney, intestine, muscle, and brain, were collected for pathological analyses. Results showed that the SFTSV could infect Balb/C mice and hamsters with SFTSV-specific immunoglobulin (Ig) M and IgG antibodies detected in plasma samples on day 7 post inoculation. The SFTSV-specific IgM levels peaked on day 7 post inoculation and then decreased, whereas the SFTSV-specific IgG levels started to increase on day 7 and then peaked on day 14 post inoculation. Pathological analyses indicated significant pathological lesions in liver and kidney tissues. In conclusion, SFTSV could can infect different strains of rodent animals and cause similar immunological and pathological responses.
Animals ; Antibody Specificity ; Bunyaviridae Infections ; blood ; pathology ; Cricetinae ; Immunoglobulin G ; blood ; Immunoglobulin M ; blood ; Leukocyte Count ; Mice ; Mice, Inbred BALB C ; Organ Specificity ; Phlebovirus ; immunology ; physiology

AIMTo investigate the bioactive constituents from the mycelium of Penicillium thomii. Which isolated from Anemone collected in Qingdao beach.

METHODSThe constituents were separated by using various chromatography and the structures were identified on the basis of extensive spectral analysis.

RESULTSFive compounds, namely penicillixanthone A (I), p-methylbenzolic acid (II), 1-O-hexadecanoyl-2-O-(9-octadecenoyl)-3-O-(9, 12-octadecadienoyl) glycerol (III), 5 alpha, 8 alpha-epidioxy-24 zeta-methylcholesta-6, 22-dien-3 beta-ol (IV) and 1, 6, 8-trihydroxyl-3-methyl-9, 10-anthracenedione (V), were isolated from the mycelium of Penicillium thomii.

CONCLUSIONPenicillixanthone A is a new compound, while the others are isolated from Penicillium thomii for the first time.

Animals ; Molecular Conformation ; Molecular Structure ; Penicillium ; chemistry ; isolation & purification ; Sea Anemones ; microbiology ; Xanthones ; chemistry ; isolation & purification