Objective: To evaluate the clinical efficacy of sinew-regulating bone-setting manipulations plus exercise therapy in treating chronic non-specific low back pain (CNLBP). Methods: A total of 65 CNLBP patients were divided into two groups by the random number table method. Thirty-three cases in the treatment group were intervened by sinew-regulating bone-setting manipulations plus exercise therapy; 32 cases in the control group were intervened by medium-frequency electrotherapy plus exercise therapy. Before and after treatment, visual analog scale (VAS), dynamic and static muscle endurance of low back, median frequency (MF) of surface electromyography (sEMG) and Oswestry disability index (ODI) were used to evaluate the low back function. The therapeutic efficacy was estimated after treatment. Results: The two groups each had 2 dropouts during the study. The total effective rate was 90.3％ in the treatment group versus 66.7％ in the control group, and the between-group difference was statistically significant (P<0.05). After treatment, the VAS score, dynamic and static muscle endurance of low back, MF of sEMG and ODI score all changed significantly in both groups (all P<0.05); all the items in the treatment group were significantly different from those in the control group (all P<0.05). Conclusion: Sinew-regulating bone-setting manipulations plus exercise therapy can effectively release pain in CNLBP patients, increase muscle endurance of the low back and improve the quality of life, and its therapeutic efficacy is more significant than that of medium-frequency electrotherapy plus exercise therapy.

Objective To investigate the blood pressure status of preschool children in urban areas of Qingdao, and to determine the relationship between obesity and blood pressure in preschool children. Methods A stratified cluster sampling method was used to select a total of 13 kindergartens in urban districts of Qingdao. Height, weight, waist circumference, hip circumference and blood pressure of children in three classes were measured. Body mass index (BMI), waist to hip ratio and waist to height ratio were calculated and the relationship between obesity and blood pressure was analyzed. Results The mean values of systolic and diastolic blood pressure in preschool children in urban areas of Qingdao were (95.52±7.66) and (62.78±6.52) mmHg, respectively.The detection rate of hypertension in preschool children was 13.50%. The SBP and DBP were positively correlated with BMI, waist circumference, hip circumference and waist to height ratio. There was a linear regression relationship between body mass index and age and blood pressure. The risk of hypertension in overweight and obese children was 5.191 and 2.824 times of normal body weight, respectively. Conclusions The prevalence of hypertension in preschool children in Qingdao urban areas is high.Overweight and obesity are risk factors for elevated blood pressure.Therefore, while preventing preschool children from obesity, preschool children's blood pressure monitoring and blood pressure monitoring and early intervention of hypertension of preschool children should be implemented.

Background: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATITA-GAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOV A)in R software.Results: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90％to 99.97％),followed by many other fungal groups(each ＜1.41％).ITS genotype was 4efined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P = 0.0014)between infectious group and control group was observed.Conclusions: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.

The purpose of our present work was to study the discharge of bursting-firing neurons (BFNs) in ipsilateral or contralateral hippocampus (HPC), and its relations to the reestablishment of local epileptic networks. The experiments were performed on 140 Sprague Dawley male rats (150-250 g). Acute tetanization (60 Hz, 2 s, 0.4 -0.6 mA) of the right posterior dorsal hippocampus (ATPDH) was administered to establish rat epilepsy model. The single unit discharges and the depth electrographs were simultaneously recorded from ipsilateral or contralateral HPC. In other experimental rats, acute tetanization of the right anterior dorsal HPC (ATADH) was used. Extracellular unit discharges in the CA1 region were simultaneously recorded from bilateral anterior dorsal hippocampi. Analysis of hippocampal BFN firing patterns before or after administration of the tetanization was focused on according to their location in the HPC epileptic networks in vivo. Single unit discharges of 138 hippocampal neurons were recorded from ipsilateral and/or contralateral anterior dorsal HPC. Of the 138 neurons recorded, 19 were BFNs. 13 BFNs were tetanus-evoked and the remaining 6 were spontaneous ones. The evoked reactions of the single hippocampal neuron induced by the tetanization mainly included: (1) the firing patterns of the BFNs in ipsilateral anterior dorsal HPC were obviously modulated by the ATPDH from tonic firing into rhythmic bursting. The bursting interspike intervals (BISI) decreased. (2) There were mild modulations of the firing patterns of the BFNs in contralateral anterior dorsal HPC following post-inhibition of the firing rate of single neuron induced by the ATPDH. The interspike intervals (ISI) increased obviously. (3) Post-facilitation of rhythmic bursting-firing of the BFNs in contralateral anterior dorsal HPC was induced by ATADH; both the ISI and the IBI increased. (4) Synchronous or asynchronous rhythmic bursting-firing of the BFNs and the network epileptiform events ipsilateral or contralateral anterior dorsal HPC were elicited by the ATPDH. The results obtained suggest that bursting-firing of single BFNs is produced by the ATPDH in the anterior dorsal HPC along the longitudinal axis of the ipsilateral HPC or across the hemisphere to the opposite HPC. Rhythmic activities of the BFN may be implicated in the epileptic network reestablishment of the HPC. On the other hand, synaptic modulation of the BFN temporal series might be responsible for pathophysiological information transmission in the HPC-epileptic network.
Animals ; Electric Stimulation ; Electrophysiology ; Epilepsy, Temporal Lobe ; physiopathology ; Evoked Potentials ; Hippocampus ; physiopathology ; Male ; Nerve Net ; physiopathology ; Neurons ; physiology ; Rats ; Rats, Sprague-Dawley ; Synaptic Transmission

The purpose of the present work was to study the role of unilateral hippocampal neural network in hippocampal epileptogenesis and its cellular mechanisms. Experiments were performed on 45 Sprague-Dawley adult rats. Acute tetanization (60 Hz, 2 s, 0.4 - 0.6 mA) of the right posterior dorsal hippocampus (ATPDH) was used to induce hippocampal epilepsy. The single unit discharges and the depth electrographs were synchronously recorded with a glass microelectrode and a pair of stainless concentric electrodes in the ipsilateral anterior dorsal hippocampus (HPC). The results demonstrated that: (1) some primary unit after-discharges were synchronized with electrographic after-discharges in the anterior dorsal HPC network after eight or nine tetanic trains were administered. Others desynchronized with 5 - 90 Hz primary depth electrographic after-discharges; (2) primary electrographic after-discharges were driven by primary unit after-discharges in the anterior dorsal HPC; (3) primary unit after-discharges were induced by brief primary electrographic after-discharges; and (4) plasticity of primary electrographic after-discharges and inhibition of single neuron firing were induced by repetitive ATPDH. The results suggest that hippocampal pathophysiologic network along the temporal-septal axis of the HPC is re-established by the repetitive ATPDH. There are plastic interactions between single neurons and its network during this re-establishment, which may be involved in the generation of "seizure oscillation". Over-activation of an intrinsic inhibition of the HPC along its temporal-septal axis might be involved in hippocampal network epileptogenesis.
Animals ; Electric Stimulation ; Epilepsy, Temporal Lobe ; physiopathology ; Evoked Potentials ; Hippocampus ; physiopathology ; Male ; Nerve Net ; physiopathology ; Neurons ; physiology ; Rats ; Rats, Sprague-Dawley

Objective To analyse the epidemiological and clinical characteristics of different pathogenesis type cases,severe and common cages of hand,foot and mouth disease.Methods Deseriptive epidemic method Was used to analyse the epidemiological and clinical characteristics of labomtory-confirmed cases with hand,foot and mouth disease.Results The epidemiological characteristics 113 cages were the same as epidemic situation at the same time in Anji county.Clinical characteristics were difference in different pathogenesis type cases,severe and common cases of hand,foot and mouth disease.Conclusion Prevention and control work taken should according to the characteristics of the disease,such as early identification of severe cages,handling and controlling over the outbreaks in order to reduce the severe cases and the death.

BACKGROUNDThe adjunction of ultrasound to nerve stimulation has been proven to improve single-injection peripheral nerve block quality. However, few reports have been published determining whether ultrasound can facilitate continuous nerve blocks. In this study, we tested the hypothesis that the addition of ultrasound to nerve stimulation facilitates femoral nerve blocks with a stimulating catheter.

METHODSIn this prospective randomized study, patients receiving continuous femoral nerve blocks for total knee replacement were randomly assigned to either the ultrasound guidance combined with stimulating catheter group (USNS group; n = 60) or the stimulating catheter alone group (NS group; n = 60). The primary end point was the procedure time (defined as the time from first needle contact with the skin until correct catheter placement). The numbers of needle passes and catheter insertions, onset and quality of femoral nerve blocks, postoperative pain score, and early knee function were also recorded.

RESULTSThe procedure time was significantly less in the USNS group than in the NS group (9.0 (6.0 - 22.8) minutes vs. 13.5 (6.0 - 35.9) minutes, P = 0.024). The numbers of needle passes and catheter insertions were also significantly less in the USNS group. A greater complete block rate was achieved at 30 minutes in the USNS group (63.3% vs. 38.3%; P = 0.010). The postoperative pain score, the number of patients who required bolus local anesthetic and intravenous patient-controlled analgesia, and knee flexion on the second postoperative day were not significantly different between the two groups of patients.

CONCLUSIONSUltrasound-assisted placement of a stimulating catheter for femoral nerve blocks decreases the time necessary to perform the block compared with just the nerve-stimulating technique. In addition, a more complete blockade is achieved using the ultrasound-assisted technique.

Aged ; Aged, 80 and over ; Catheterization ; methods ; Female ; Femoral Nerve ; diagnostic imaging ; Humans ; Male ; Middle Aged ; Nerve Block ; instrumentation ; methods ; Ultrasonography

Objective :To construct and identify a ScFv phage display library against human umbilical cord mesenchymal stem cells.Methods: BALB/c mice were immunized with cultured UC-MSCs.After the third immunization,the total RNA was extracted from the spleen cells of the immunized BALB/c mice and purified by affinity chromatography with mRNA Purification Kit.The heavy-chain and light-chain variable region genes(VH and VL) were amplified by PCR using relevant primers.PCR products of VH and VL genes were cloned into the phagemid vector pSEX81 and electroporated into the XL1-Blue strain of E.coli.The ScFv phage display library against human umbilical cord mesenchymal stem cells was constructed and the capacity of library was measured.The library was panned by three cycles and screened with purified UC-MSCs.The percentage of clones containing a full-length scFv-encoding insert and their diversity was determined for unselected and selected libraries.Results: The amplified fragments of VH and VL genes by RT-PCR were about 399bp and 357bp,respectively.VH and VL genes were all successfully cloned into the phagemid vector pSEX81,which were confirmed by the amplication of 786bp full-length scFv fragments by PCR.The ScFv phage display library had a capacity of approximately 2?107 cfu.After three cycles of panning,PCR of plasmid DNA prepared from 15 individual phage clones showed that the recombination rate increased from 93% to 100%.BstN1 fingerprinting of insert DNA showed that the diversity of clones decreased with increasing rounds of selection.After three rounds of selection,3 clones showed an identical restriction enzyme pattern.There was a 330-fold enrichment of library phage after 2 rounds of selection and after 3 rounds,a further 8-fold enrichment of library phage was obtained.Conclusion: The ScFv phage display library against human umbilical cord mesenchymal stem cells was successfully constructed.It can be used for succeeding screening of specific antibody against human umbilical cord mesenchymal stem cells and further studying of the cell surface molecules of mesenchymal stem cells.

OBJECTIVETo discuss the clinical findings and treatment of paraneoplastic pemphigus (PNP) with Castleman's disease.

METHODSTo investigate the clinical, histopathologic and CT findings of 8 cases paraneoplastic pemphigus with Castleman's disease.

RESULTSAll of 8 patients were diagnosed PNP first and were found Castleman's tumor incidently during routine examination. All 8 cases showed severe erosion or ulcer of the oral mucosa with various skin lesions. Histopathologically, there were intraepidermal acantholytic vesicle, basal cell liquefaction, necrotic keratinocytes in the epidermis and lymphocyte infiltration in the upper dermis. CT scan appeared solitary mass in these patients. Some of them were attacked by bronchiolitis obliterans. All 8 patients were failed by use of predisone. Obvious relief of PNP and pulmonary lesion occurred after tumor was rescted.

CONCLUSIONSParaneoplastic pemphigus with Castleman's disease is a rare disease. The key step is to find and resect the tumor in abdomen. CT scan should be used to detect the tumor in patients with PNP, especially, when predisone was failed in treatment.

Adolescent ; Adult ; Castleman Disease ; complications ; diagnosis ; therapy ; Combined Modality Therapy ; Female ; Humans ; Male ; Paraneoplastic Syndromes ; complications ; diagnosis ; therapy ; Pemphigus, Benign Familial ; complications ; diagnosis ; therapy ; Retrospective Studies

Objective To investigate the distribution characteristics of traditional Chinese medicine(TCM)syndromes in girls with idiopathic central precocious puberty(ICPP)from Hainan province.Methods A total of 216 cases of ICPP girls admitted to Hainan Women and Children's Medical Centre from January 2019 to December 2021 were retrospectively collected.The frequency statistics and grading of TCM syndromes in the included ICPP girls were carried out,and the distribution characteristics of TCM syndromes were discussed on the basis of the analysis of the three TCM syndrome types of yin deficiency and fire exuberance syndrome,qi and blood insufficiency syndrome and incoordination between heart and kidney syndrome.Results(1)The age of ICPP onset in 216 girls were between 4 and 10 years old,with an average onset age of(7.15±1.06)years.The highest incidence rate of ICPP was found in the girls aged over 7 years old while less than 8 years old,which was 49.54%.(2)Of the three TCM syndrome types,yin deficiency and fire exuberance syndrome accounted for the highest proportion(147 cases,68.06%),followed by the qi and blood insufficiency syndrome(41 cases,18.98%)and the incoordination between heart and kidney syndrome(28 cases,12.96%).(3)The common 16 TCM symptoms(frequency＞25.0%)in descending order of frequency were aversion to heat and night sweating,feverish sensation in soles and palms,breast distension and pain,irritability,thready and rapid pulse,dry stools,dry throat and mouth,hot flushes,excessive intake of fat and sweet food,red tongue with less fur,depression,mental weakness,flushed cheeks,insomnia and dreaminess,red tongue with yellow fur,and bitterness and dryness in the mouth.(4)The distribution of the age in ICPP girls with various syndromes was as follows:yin deficiency and fire exuberance syndrome and qi and blood insufficiency syndrome were more common in the ICPP girls aged over 7 years old while less than 8 years old(accounting for 58.50%and 51.22%),and incoordination between heart and kidney syndrome was more common in ICPP girls aged over 8 years old while less than 9 years old(accounting for 89.29%).Conclusion Yin deficiency and fire exuberance syndrome is the common TCM syndrome that accounts for the highest proportion in ICPP girls from Hainan province.The study of the distribution of TCM syndromes in girls with precocious puberty will be helpful for the observation of the early clinical symptoms of precocious puberty and early diagnosis of the disease,and can provide clues and evidence for the clinical diagnosis and medication for girls with ICPP.