Objective: To retrospectively compare the safety and efficacy of ultrasound-guided radiofrequency ablation (RFA) with parotidectomy for superficial pleomorphic adenoma (PA). Materials and Methods: From March 2022 to October 2023, 88 patients diagnosed with superficial parotid PA underwent either RFA (n = 12; mean age, 47.1 years) or parotidectomy (n = 76; mean age, 47.8 years). Patients in the RFA group were matched to those in the surgery group in a 1:1 ratio using propensity scores based on age, sex, tumor volume, diameter, location, and comorbidities. Ultrasound characteristics, cosmetic scores (0–4), numerical rating scale scores (0–10), and complications were assessed before the procedures and at 1-, 3-, and 6-month follow-ups. Outcomes were compared between baseline and follow-up in the RFA group and between the RFA and surgery groups. Results: In the RFA group, significant reductions in tumor volume were observed between baseline (median, 2.02 cm 3 ) and the 1-month follow-up (median, 1.21 cm 3 ; P = 0.015), between the 1-month and 3-month follow-ups (median, 0.53 cm 3 ; P= 0.002), and between the 3- and 6-month follow-ups (median, 0.23 cm 3 ; P = 0.003). The volume reduction ratios at 1, 3, and 6 months were 39.7%, 79.9%, and 88.0%, respectively. The cosmetic score was significantly lower at 3- and 6-month followup compared to baseline (median 1 and 1 vs. 4, P = 0.04). The numerical rating scale scores did not differ significantly from baseline throughout follow-up. In the propensity score-matched analysis (12 patients per group), RFA was associated with a shorter median procedure time (61.5 vs. 253.3 minutes; P < 0.001), shorter hospital stay (0 vs. 4 days; P < 0.001), and lower cost (1859.9 vs. 3512.4 USD; P < 0.001) than parotidectomy, with no significant difference in overall complication rates (33.3% [4/12] vs. 41.7% [5/12]; P = 1.000). Conclusion RFA may be a safe and effective alternative to surgery for superficial parotid PA, offering a shorter median procedure time, shorter hospital stay, and lower costs.

Objective: To retrospectively compare the safety and efficacy of ultrasound-guided radiofrequency ablation (RFA) with parotidectomy for superficial pleomorphic adenoma (PA). Materials and Methods: From March 2022 to October 2023, 88 patients diagnosed with superficial parotid PA underwent either RFA (n = 12; mean age, 47.1 years) or parotidectomy (n = 76; mean age, 47.8 years). Patients in the RFA group were matched to those in the surgery group in a 1:1 ratio using propensity scores based on age, sex, tumor volume, diameter, location, and comorbidities. Ultrasound characteristics, cosmetic scores (0–4), numerical rating scale scores (0–10), and complications were assessed before the procedures and at 1-, 3-, and 6-month follow-ups. Outcomes were compared between baseline and follow-up in the RFA group and between the RFA and surgery groups. Results: In the RFA group, significant reductions in tumor volume were observed between baseline (median, 2.02 cm 3 ) and the 1-month follow-up (median, 1.21 cm 3 ; P = 0.015), between the 1-month and 3-month follow-ups (median, 0.53 cm 3 ; P= 0.002), and between the 3- and 6-month follow-ups (median, 0.23 cm 3 ; P = 0.003). The volume reduction ratios at 1, 3, and 6 months were 39.7%, 79.9%, and 88.0%, respectively. The cosmetic score was significantly lower at 3- and 6-month followup compared to baseline (median 1 and 1 vs. 4, P = 0.04). The numerical rating scale scores did not differ significantly from baseline throughout follow-up. In the propensity score-matched analysis (12 patients per group), RFA was associated with a shorter median procedure time (61.5 vs. 253.3 minutes; P < 0.001), shorter hospital stay (0 vs. 4 days; P < 0.001), and lower cost (1859.9 vs. 3512.4 USD; P < 0.001) than parotidectomy, with no significant difference in overall complication rates (33.3% [4/12] vs. 41.7% [5/12]; P = 1.000). Conclusion RFA may be a safe and effective alternative to surgery for superficial parotid PA, offering a shorter median procedure time, shorter hospital stay, and lower costs.

Objective: To retrospectively compare the safety and efficacy of ultrasound-guided radiofrequency ablation (RFA) with parotidectomy for superficial pleomorphic adenoma (PA). Materials and Methods: From March 2022 to October 2023, 88 patients diagnosed with superficial parotid PA underwent either RFA (n = 12; mean age, 47.1 years) or parotidectomy (n = 76; mean age, 47.8 years). Patients in the RFA group were matched to those in the surgery group in a 1:1 ratio using propensity scores based on age, sex, tumor volume, diameter, location, and comorbidities. Ultrasound characteristics, cosmetic scores (0–4), numerical rating scale scores (0–10), and complications were assessed before the procedures and at 1-, 3-, and 6-month follow-ups. Outcomes were compared between baseline and follow-up in the RFA group and between the RFA and surgery groups. Results: In the RFA group, significant reductions in tumor volume were observed between baseline (median, 2.02 cm 3 ) and the 1-month follow-up (median, 1.21 cm 3 ; P = 0.015), between the 1-month and 3-month follow-ups (median, 0.53 cm 3 ; P= 0.002), and between the 3- and 6-month follow-ups (median, 0.23 cm 3 ; P = 0.003). The volume reduction ratios at 1, 3, and 6 months were 39.7%, 79.9%, and 88.0%, respectively. The cosmetic score was significantly lower at 3- and 6-month followup compared to baseline (median 1 and 1 vs. 4, P = 0.04). The numerical rating scale scores did not differ significantly from baseline throughout follow-up. In the propensity score-matched analysis (12 patients per group), RFA was associated with a shorter median procedure time (61.5 vs. 253.3 minutes; P < 0.001), shorter hospital stay (0 vs. 4 days; P < 0.001), and lower cost (1859.9 vs. 3512.4 USD; P < 0.001) than parotidectomy, with no significant difference in overall complication rates (33.3% [4/12] vs. 41.7% [5/12]; P = 1.000). Conclusion RFA may be a safe and effective alternative to surgery for superficial parotid PA, offering a shorter median procedure time, shorter hospital stay, and lower costs.

Objective: To retrospectively compare the safety and efficacy of ultrasound-guided radiofrequency ablation (RFA) with parotidectomy for superficial pleomorphic adenoma (PA). Materials and Methods: From March 2022 to October 2023, 88 patients diagnosed with superficial parotid PA underwent either RFA (n = 12; mean age, 47.1 years) or parotidectomy (n = 76; mean age, 47.8 years). Patients in the RFA group were matched to those in the surgery group in a 1:1 ratio using propensity scores based on age, sex, tumor volume, diameter, location, and comorbidities. Ultrasound characteristics, cosmetic scores (0–4), numerical rating scale scores (0–10), and complications were assessed before the procedures and at 1-, 3-, and 6-month follow-ups. Outcomes were compared between baseline and follow-up in the RFA group and between the RFA and surgery groups. Results: In the RFA group, significant reductions in tumor volume were observed between baseline (median, 2.02 cm 3 ) and the 1-month follow-up (median, 1.21 cm 3 ; P = 0.015), between the 1-month and 3-month follow-ups (median, 0.53 cm 3 ; P= 0.002), and between the 3- and 6-month follow-ups (median, 0.23 cm 3 ; P = 0.003). The volume reduction ratios at 1, 3, and 6 months were 39.7%, 79.9%, and 88.0%, respectively. The cosmetic score was significantly lower at 3- and 6-month followup compared to baseline (median 1 and 1 vs. 4, P = 0.04). The numerical rating scale scores did not differ significantly from baseline throughout follow-up. In the propensity score-matched analysis (12 patients per group), RFA was associated with a shorter median procedure time (61.5 vs. 253.3 minutes; P < 0.001), shorter hospital stay (0 vs. 4 days; P < 0.001), and lower cost (1859.9 vs. 3512.4 USD; P < 0.001) than parotidectomy, with no significant difference in overall complication rates (33.3% [4/12] vs. 41.7% [5/12]; P = 1.000). Conclusion RFA may be a safe and effective alternative to surgery for superficial parotid PA, offering a shorter median procedure time, shorter hospital stay, and lower costs.

Objective: To retrospectively compare the safety and efficacy of ultrasound-guided radiofrequency ablation (RFA) with parotidectomy for superficial pleomorphic adenoma (PA). Materials and Methods: From March 2022 to October 2023, 88 patients diagnosed with superficial parotid PA underwent either RFA (n = 12; mean age, 47.1 years) or parotidectomy (n = 76; mean age, 47.8 years). Patients in the RFA group were matched to those in the surgery group in a 1:1 ratio using propensity scores based on age, sex, tumor volume, diameter, location, and comorbidities. Ultrasound characteristics, cosmetic scores (0–4), numerical rating scale scores (0–10), and complications were assessed before the procedures and at 1-, 3-, and 6-month follow-ups. Outcomes were compared between baseline and follow-up in the RFA group and between the RFA and surgery groups. Results: In the RFA group, significant reductions in tumor volume were observed between baseline (median, 2.02 cm 3 ) and the 1-month follow-up (median, 1.21 cm 3 ; P = 0.015), between the 1-month and 3-month follow-ups (median, 0.53 cm 3 ; P= 0.002), and between the 3- and 6-month follow-ups (median, 0.23 cm 3 ; P = 0.003). The volume reduction ratios at 1, 3, and 6 months were 39.7%, 79.9%, and 88.0%, respectively. The cosmetic score was significantly lower at 3- and 6-month followup compared to baseline (median 1 and 1 vs. 4, P = 0.04). The numerical rating scale scores did not differ significantly from baseline throughout follow-up. In the propensity score-matched analysis (12 patients per group), RFA was associated with a shorter median procedure time (61.5 vs. 253.3 minutes; P < 0.001), shorter hospital stay (0 vs. 4 days; P < 0.001), and lower cost (1859.9 vs. 3512.4 USD; P < 0.001) than parotidectomy, with no significant difference in overall complication rates (33.3% [4/12] vs. 41.7% [5/12]; P = 1.000). Conclusion RFA may be a safe and effective alternative to surgery for superficial parotid PA, offering a shorter median procedure time, shorter hospital stay, and lower costs.

Neurodegenerative diseases (NDDs) are a group of heterogeneous neurological disorders that can cause progressive loss of neurons in the central nervous system or peripheral nervous system, resulting in a decline in motor function. Motion capture, as a high-precision and high-resolution technology for capturing human motion data, drives NDDs motor assessment to effectively extract kinematic features and thus assess the patient's motor ability or disease severity. This paper focuses on the recent research progress in motor assessment of NDDs driven by motion capture data. Based on a brief introduction of NDDs motor assessment datasets, we categorized the assessment methods into three types according to the way of feature extraction and processing: NDDs motor assessment methods based on statistical analysis, machine learning and deep learning. Then, we comparatively analyzed the technical points and characteristics of the three types of methods from the aspects of data composition, data preprocessing, assessment methods, assessment purposes and effects. Finally, we discussed and prospected the development trends of NDDs motor assessment.
Humans ; Neurodegenerative Diseases/diagnosis* ; Machine Learning ; Biomechanical Phenomena ; Deep Learning ; Motion ; Motion Capture

Extensive studies have identified potential adverse effects on semen quality of obesity, based on body mass index, but the association between body fat distribution, a more relevant indicator for obesity, and semen quality remains less clear. We conducted a longitudinal study of 4304 sperm donors from the Guangdong Provincial Human Sperm Bank (Guangzhou, China) during 2017-2021. A body composition analyzer was used to measure total and local body fat percentage for each participant. Generalized estimating equations were employed to assess the association between body fat percentage and sperm count, motility, and morphology. We estimated that each 10% increase in total body fat percentage (estimated change [95% confidence interval, 95% CI]) was significantly associated with a 0.18 × 10 6 (0.09 × 10 6 -0.27 × 10 6 ) ml and 12.21 × 10 6 (4.52 × 10 6 -19.91 × 10 6 ) reduction in semen volume and total sperm count, respectively. Categorical analyses and exposure-response curves showed that the association of body fat distribution with semen volume and total sperm count was stronger at higher body fat percentages. In addition, the association still held among normal weight and overweight participants. We observed similar associations for upper limb, trunk, and lower limb body fact distributions. In conclusion, we found that a higher body fat distribution was significantly associated with lower semen quality (especially semen volume) even in men with a normal weight. These findings provide useful clues in exploring body fat as a risk factor for semen quality decline and add to evidence for improving semen quality for those who are expected to conceive.
Humans ; Male ; Adult ; Semen Analysis ; China ; Body Fat Distribution ; Longitudinal Studies ; Sperm Count ; Sperm Motility ; Body Mass Index ; Tissue Donors ; Obesity/complications* ; Spermatozoa ; Young Adult ; Middle Aged ; East Asian People

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To investigate the influence of different scanning conditions on the image quality of medical electron accelerator cone-beam computed tomography (CBCT) and provide a reference for the selection of scanning conditions for different body parts. Methods Set different scanning conditions, the Catphan 503 phantom was scanned using CBCT parameters to analyze the influence of spatial resolution, noise, uniformity, spatial geometric accuracy, and low-contrast resolution on the image quality of CBCT. RESULTS: For the head, chest, and abdomen, with the increase in scanning parameter values, the noise value decreased by 47.4%, 26.1%, and 51.3% respectively, and the uniformity values decreased by 30.2%, 26.6%, and 47.9% respectively. The low-contrast resolution values decreased by 50.6%, 34.2%, and 12.0%. The influence of different scanning conditions on spatial geometric accuracy and spatial resolution is not significant. CONCLUSION Different scanning parameters have a certain influence on the image quality of medical electron accelerator CBCT. Lower scanning parameters can be selected based on individual patients to reduce the additional radiation dose, providing a reference for the safe application of CBCT image guidance in radiotherapy.
Cone-Beam Computed Tomography/instrumentation* ; Phantoms, Imaging ; Particle Accelerators