ObjectiveThis paper aims to investigate the material basis of the anti-inflammatory efficacy and mechanism of action of Bushen Tongdu prescription （BSTDP）. MethodsThe chemical components of BSTDP and its blood-absorbed components in vivo were systematically identified by using ultra-performance liquid chromatography-linear ion trap-electrostatic field orbitrap high-resolution mass spectrometry （UPLC-LIT-Orbitrap-MS）. Network pharmacology was employed to screen blood-absorbed bioactive components and potential targets of this formula. A protein-protein interaction （PPI） network of core targets was constructed to conduct enrichment analysis. Molecular docking was further utilized to verify the binding affinity between key components and targets. The inflammatory model was established and verified in vivo by using a transgenic zebrafish Tg （mpx： GFP）. At three days post-fertilization （3 dpf）， larvae of zebrafish were randomly assigned to blank group， model group， positive drug dexamethasone acetate group （75 μmol·L^-1）， and BSTDP groups with low， medium， and high doses （500， 1 000， and 2 000 mg·L^-1）. The distribution and quantity of neutrophils in the yolk sac region were observed under a fluorescence microscope. The mRNA expression levels of key genes in the toll-like receptor 4 （TLR4）/myeloid differentiation factor 88 （MyD88）/nuclear factor kappa-B （NF-κB） signaling pathway and inflammatory factors including interleukin （IL）-1β， IL-6， and tumor necrosis factor-α （TNF-α） were detected by Real-time quantitative polymerase chain reaction （Real-time PCR）. ResultsA total of 120 chemical components were identified in BSTDP， among which 26 original components were confirmed by using serum pharmacochemical methods. A total of 227 common targets linking rheumatoid arthritis （RA） and the blood-absorbed components were screened by network pharmacology. It is suggested that pseudobrucine， vomicine， sinapine， rehmannioside， cinnamyl alcohol glycoside， and methylephedrine exert anti-inflammatory effects by acting on core targets including protein kinase B1 （Akt1）， signal transducer and activator of transcription 3 （STAT3）， tumor necrosis factor （TNF）， TLR4， mitogen-activated protein kinase 14 （MAPK14）， and phosphatidylinositol-4，5-bisphosphate 3-kinase catalytic subunit α （PIK3CA）， thereby modulating multiple signaling pathways such as TLR4 and NF-κB. In vivo verification in zebrafish demonstrates that the maximum tolerable concentration of Bushen Tongdu Formula is 2 000 mg·L^-1. Compared to those in the blank group， zebrafish in the model group showed a significantly higher number of neutrophils in the yolk sac region （P<0.01） and rising mRNA levels of TLR4， MyD88， NF-κB， TNF-α， IL-6， and IL-1β （P<0.01）. Compared to that in the model group， the number of neutrophils was significantly reduced in BSTDP groups with medium and high doses， as well as the dexamethasone acetate group （P<0.05， P<0.01）. There was no statistically significant difference in the low dose group. The mRNA expression levels of TLR4， MyD88， NF-κB， TNF-α， IL-6， and IL-1β were significantly down-regulated （P<0.05， P<0.01）. ConclusionThis paper identifies the material basis of the efficacy of BSTDP， demonstrating that the formula can exert an anti-inflammatory effect through the TLR4/MyD88/NF-κB signaling pathway. The results provide scientific experimental evidence for its further clinical application.

ObjectiveThis paper aims to investigate the material basis of the anti-inflammatory efficacy and mechanism of action of Bushen Tongdu prescription （BSTDP）. MethodsThe chemical components of BSTDP and its blood-absorbed components in vivo were systematically identified by using ultra-performance liquid chromatography-linear ion trap-electrostatic field orbitrap high-resolution mass spectrometry （UPLC-LIT-Orbitrap-MS）. Network pharmacology was employed to screen blood-absorbed bioactive components and potential targets of this formula. A protein-protein interaction （PPI） network of core targets was constructed to conduct enrichment analysis. Molecular docking was further utilized to verify the binding affinity between key components and targets. The inflammatory model was established and verified in vivo by using a transgenic zebrafish Tg （mpx： GFP）. At three days post-fertilization （3 dpf）， larvae of zebrafish were randomly assigned to blank group， model group， positive drug dexamethasone acetate group （75 μmol·L^-1）， and BSTDP groups with low， medium， and high doses （500， 1 000， and 2 000 mg·L^-1）. The distribution and quantity of neutrophils in the yolk sac region were observed under a fluorescence microscope. The mRNA expression levels of key genes in the toll-like receptor 4 （TLR4）/myeloid differentiation factor 88 （MyD88）/nuclear factor kappa-B （NF-κB） signaling pathway and inflammatory factors including interleukin （IL）-1β， IL-6， and tumor necrosis factor-α （TNF-α） were detected by Real-time quantitative polymerase chain reaction （Real-time PCR）. ResultsA total of 120 chemical components were identified in BSTDP， among which 26 original components were confirmed by using serum pharmacochemical methods. A total of 227 common targets linking rheumatoid arthritis （RA） and the blood-absorbed components were screened by network pharmacology. It is suggested that pseudobrucine， vomicine， sinapine， rehmannioside， cinnamyl alcohol glycoside， and methylephedrine exert anti-inflammatory effects by acting on core targets including protein kinase B1 （Akt1）， signal transducer and activator of transcription 3 （STAT3）， tumor necrosis factor （TNF）， TLR4， mitogen-activated protein kinase 14 （MAPK14）， and phosphatidylinositol-4，5-bisphosphate 3-kinase catalytic subunit α （PIK3CA）， thereby modulating multiple signaling pathways such as TLR4 and NF-κB. In vivo verification in zebrafish demonstrates that the maximum tolerable concentration of Bushen Tongdu Formula is 2 000 mg·L^-1. Compared to those in the blank group， zebrafish in the model group showed a significantly higher number of neutrophils in the yolk sac region （P<0.01） and rising mRNA levels of TLR4， MyD88， NF-κB， TNF-α， IL-6， and IL-1β （P<0.01）. Compared to that in the model group， the number of neutrophils was significantly reduced in BSTDP groups with medium and high doses， as well as the dexamethasone acetate group （P<0.05， P<0.01）. There was no statistically significant difference in the low dose group. The mRNA expression levels of TLR4， MyD88， NF-κB， TNF-α， IL-6， and IL-1β were significantly down-regulated （P<0.05， P<0.01）. ConclusionThis paper identifies the material basis of the efficacy of BSTDP， demonstrating that the formula can exert an anti-inflammatory effect through the TLR4/MyD88/NF-κB signaling pathway. The results provide scientific experimental evidence for its further clinical application.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

Objective:To investigate the efficacy of radiotherapy in patients with advanced esophageal cancer receiving first-line chemoimmunotherapy.Methods:A retrospective analysis was conducted on the data of 137 patients with Stage Ⅳ esophageal squamous cell carcinoma (ESCC) treated at our hospital from January 2018 to May 2023. These patients were divided into two groups: a group treated with first-line chemoimmunotherapy combined with radiotherapy (chemoimmunotherapy + radiotherapy group, n = 43) and a group treated with only chemoimmunotherapy ( n = 94). Inverse probability of treatment weighting (IPTW) was applied to balance baseline characteristics between the groups. With overall survival (OS) and progression-free survival (PFS) as study endpoints, the survival data were analyzed using the Kaplan-Meier method, the log-rank test, and the Cox regression method. Results:Before calibration, the chemoimmunotherapy + radiotherapy group significantly outperformed the sole chemoimmunotherapy group in median PFS (13.6 months vs. 7.0 months; HR: 0.501, 95% CI: 0.309-0.811, P = 0.005). After calibration using the COX proportional-hazards model for age, gender, Eastern Cooperative Oncology Group (ECOG) performance status, smoking history, T/N/M stage, and tumor location, the chemoimmunotherapy + radiotherapy group still had significant advantages in PFS (14.7 months vs. 7.0 months; HR: 0.441, 95% CI: 0.261-0.745, P = 0.002). IPTW analysis further confirmed this trend (13.9 months vs. 7.0 months; HR: 0.492, 95% CI: 0.304-0.795, P < 0.001). Specifically, the median OS of the chemoimmunotherapy + radiotherapy group demonstrated significant improvement in all analyses: pre-calibration (29.5 months vs. 18.0 months; HR: 0.507, 95% CI: 0.297-0.867, P = 0.013), after calibration using the Cox model (27.5 months vs. 16.7 months; HR: 0.470, 95% CI: 0.266-0.830, P = 0.009), and after calibration using IPTW (29.5 months vs. 16.9 months; HR: 0.448, 95% CI: 0.262-0.764, P < 0.001). Conclusions:The combination of radiotherapy and first-line chemoimmunotherapy can significantly improve survival outcomes of patients with advanced ESCC, suggesting its potential as a standard treatment strategy.

The zebrafish model has attracted much attention due to its strong reproductive ability, short research cycle, and ease of maintenance. It has always been an important vertebrate model system, often used to carry out human disease research. Its motor behavior features have the advantages of being simpler, more intuitive, and quantifiable. In recent years, it has received widespread attention in the study of traditional Chinese medicine(TCM)for the treatment of sleep disorders, neurodegenerative diseases, fatigue, epilepsy, and other diseases. This paper reviews the characteristics of zebrafish motor behavior and its applications in the pharmacodynamic verification and mechanism research of TCM extracts, active ingredients, and TCM compounds, as well as in active ingredient screening and safety evaluation. The paper also analyzes its advantages and disadvantages, with the aim of improving the breadth and depth of zebrafish and its motor behavior applications in the field of TCM research.
Zebrafish/physiology* ; Medicine, Chinese Traditional ; Drugs, Chinese Herbal/therapeutic use* ; Disease Models, Animal ; Drug Evaluation, Preclinical/methods* ; Animals ; Sleep Wake Disorders/physiopathology* ; Epilepsy/physiopathology* ; Neurodegenerative Diseases/physiopathology* ; Fatigue/physiopathology* ; Behavior, Animal/physiology* ; Motor Activity/physiology*

To elucidate the mechanism by which steaming affects the quality of Curcuma kwangsiensis root tubers, methods such as LSCM, RVA, dual-wavelength spectrophotometry, LF-NMR, and LC-MS were employed to qualitatively and quantitatively detect changes in starch gelatinization characteristics, water distribution, and material composition of C. kwangsiensis root tubers under different steaming durations. Based on multivariate statistical analysis, the correlation between differences in gelatinization parameters, water distribution, and terpenoid material composition was investigated. The results indicate that steaming affects both starch gelatinization and water distribution in C. kwangsiensis. During the steaming process, transformations occur between amylose and amylopectin, as well as between semi-bound water and free water. After 60 min of steaming, starch gelatinization and water distribution reached an equilibrium state. The content of amylopectin, the amylose-to-amylopectin ratio, and parameters such as gelatinization temperature, viscosity, breakdown value, and setback value were significantly correlated(P≤0.05). Additionally, the amylose-to-amylopectin ratio was significantly correlated with total free water and total water content(P≤0.05). Steaming induced differences in the material composition of C. kwangsiensis root tubers. Clustering of primary metabolites in the OPLS-DA model was distinct, while secondary metabolites were classified into 9 clusters using the K-means clustering algorithm. Differential terpenoid metabolites such as(-)-α-curcumene were significantly correlated with zerumbone, retinal, and all-trans-retinoic acid(P<0.05). Curcumenol was significantly correlated with isoalantolactone and ursolic acid(P<0.05), while all-trans-retinoic acid was significantly correlated with both zerumbone and retinal(P<0.05). Alpha-tocotrienol exhibited a significant correlation with retinal and all-trans-retinoic acid(P<0.05). Amylose was extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and α-tocotrienol(P<0.05). Amylopectin was significantly correlated with zerumbone(P<0.05) and extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and 9-cis-retinoic acid(P<0.01). The results provide scientific evidence for elucidating the mechanism of quality formation of steamed C. kwangsiensis root tubers as a medicinal material.
Curcuma/chemistry* ; Starch/chemistry* ; Multivariate Analysis ; Water/chemistry* ; Terpenes/analysis* ; Plant Roots/chemistry* ; Plant Tubers/chemistry* ; Drugs, Chinese Herbal/chemistry*

OBJECTIVE: To determine risk factors for cutout failure in geriatric intertrochanteric fracture patients after cephalomedullary nail fixation. METHODS: A retrospective review of 518 elderly patients who underwent cephalomedullary nail fixation for intertrochanteric fractures between January 2008 and August 2018 was conducted, including 167 males and 351 females, age from 65 to 97 years old. All patients were followed up for at least one year after surgery and divided into a healed group and a cutout group based on whether the hip screw cutout occurred. Among all patients, 10 cases experienced hip screw cutout. The general information, surgical data, and radiological data of the two groups were compared, and risk factors influencing hip screw cutout were analyzed. Propensity score matching was then performed on the cutout group based on gender, age, body mass index(BMI), and American Society of Anesthesiologists(ASA), and 40 patients from the healed group were matched at a ratio of 1∶4. Key risk factors affecting hip screw cutout were further analyzed. Multivariable logistic regression analysis was conducted to evaluate associations between variables and cutout failure. RESULTS: There were no statistically significant differences between the healed group and the cutout group in terms of age, gender, BMI, ASA, and AO classification. However, statistically significant differences were observed between the two groups in terms of reduction quality(P=0.003) and tip-apex distance(TAD), P<0.001. Multivariate analysis identified poor reduction quality OR=23.138, 95%CI(2.163, 247.551), P=0.009 and TAD≥25 mm OR=30.538, 95%CI(2.935, 317.770), P=0.004 as independent risk factors for cutout failure. CONCLUSION The present study identified poor reduction quality and TAD≥25 mm as factors for cutout failure in geriatric intertrochanteric fractures treated with cephalomedullary nails. Further studies are needed to calculate the optimal TAD for cephalomedullary nails.
Humans ; Male ; Female ; Hip Fractures/surgery* ; Aged, 80 and over ; Aged ; Risk Factors ; Retrospective Studies ; Fracture Fixation, Intramedullary/adverse effects* ; Bone Nails ; Bone Screws

PURPOSE: We carried out the study aiming to explore and analyze the risk factors, the distribution of pathogenic bacteria, and their antibiotic-resistance characteristics influencing the occurrence of surgical site infection (SSI), to provide valuable assistance for reducing the incidence of SSI after traumatic fracture surgery. METHODS: A retrospective case-control study enrolling 3978 participants from January 2015 to December 2019 receiving surgical treatment for traumatic fractures was conducted at Tangdu Hospital of Air Force Medical University. Baseline data, demographic characteristics, lifestyles, variables related to surgical treatment, and pathogen culture were harvested and analyzed. Univariate analyses and multivariate logistic regression analyses were used to reveal the independent risk factors of SSI. A bacterial distribution histogram and drug-sensitive heat map were drawn to describe the pathogenic characteristics. RESULTS: Included 3978 patients 138 of them developed SSI with an incidence rate of 3.47% postoperatively. By logistic regression analysis, we found that variables such as gender (males) (odds ratio (OR) = 2.012, 95% confidence interval (CI): 1.235 - 3.278, p = 0.005), diabetes mellitus (OR = 5.848, 95% CI: 3.513 - 9.736, p < 0.001), hypoproteinemia (OR = 3.400, 95% CI: 1.280 - 9.031, p = 0.014), underlying disease (OR = 5.398, 95% CI: 2.343 - 12.438, p < 0.001), hormonotherapy (OR = 11.718, 95% CI: 6.269 - 21.903, p < 0.001), open fracture (OR = 29.377, 95% CI: 9.944 - 86.784, p < 0.001), and intraoperative transfusion (OR = 2.664, 95% CI: 1.572 - 4.515, p < 0.001) were independent risk factors for SSI, while, aged over 59 years (OR = 0.132, 95% CI: 0.059 - 0.296, p < 0.001), prophylactic antibiotics use (OR = 0.082, 95% CI: 0.042 - 0.164, p < 0.001) and vacuum sealing drainage use (OR = 0.036, 95% CI: 0.010 - 0.129, p < 0.001) were protective factors. Pathogens results showed that 301 strains of 38 species of bacteria were harvested, among which 178 (59.1%) strains were Gram-positive bacteria, and 123 (40.9%) strains were Gram-negative bacteria. Staphylococcus aureus (108, 60.7%) and Enterobacter cloacae (38, 30.9%) accounted for the largest proportion. The susceptibility of Gram-positive bacteria to Vancomycin and Linezolid was almost 100%. The susceptibility of Gram-negative bacteria to Imipenem, Amikacin, and Meropenem exceeded 73%. CONCLUSION Orthopedic surgeons need to develop appropriate surgical plans based on the risk factors and protective factors associated with postoperative SSI to reduce its occurrence. Meanwhile, it is recommended to strengthen blood glucose control in the early stage of admission and for surgeons to be cautious and scientific when choosing antibiotic therapy in clinical practice.
Humans ; Surgical Wound Infection/epidemiology* ; Male ; Female ; Risk Factors ; Retrospective Studies ; Middle Aged ; Adult ; Case-Control Studies ; Fractures, Bone/surgery* ; Aged ; Drug Resistance, Bacterial ; Logistic Models ; Anti-Bacterial Agents/therapeutic use* ; Incidence ; Bacteria/drug effects*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test