OBJECTIVE To evaluate the cost-effectiveness of finerenone combined with standard treatment regimen in the treatment of diabetic nephropathy （DN）. METHODS From the perspective of healthcare service providers， a Markov model was established to simulate the dynamic changes of each stage in DN patients who received finerenone combined with the standard treatment regimen or the standard treatment regimen alone based on the phase Ⅲ clinical trial study of finerenone for DN. Markov model was used to perform the cost-effectiveness of long-term effects and the costs of the two therapies with a simulation cycle of 4 months， a simulation period of 15 years and an annual discount rate of 5%. At the same time， one-way sensitivity analysis and probability sensitivity analysis were performed， and the stability of the results was validated. RESULTS Accumulative cost of the standard treatment regimen was 579 329.54 yuan， and the accumulative utility was 8.052 4 quality-adjusted life year （QALYs）； the accumulative cost of finerenone combined with the standard treatment regimen was 332 520.61 yuan， and the accumulative utility was 8.187 4 QALYs. Finerenone combined with the standard treatment regimen was more cost-effective. The results of one-way sensitivity analysis showed that dialysis status utility value， DN stage 3 utility value and DN stage 4 utility value had a great influence on the incremental cost-effectiveness ratio， but did not affect the robustness of the model. The results of probability sensitivity analysis showed that finerenone combined with the standard treatment regimen was more cost-effective with 100% probability. CONCLUSIONS For DN patients， finerenone combined with the standard treatment regimen is more cost-effective as an absolute advantage option.

The zebrafish model has attracted much attention due to its strong reproductive ability, short research cycle, and ease of maintenance. It has always been an important vertebrate model system, often used to carry out human disease research. Its motor behavior features have the advantages of being simpler, more intuitive, and quantifiable. In recent years, it has received widespread attention in the study of traditional Chinese medicine(TCM)for the treatment of sleep disorders, neurodegenerative diseases, fatigue, epilepsy, and other diseases. This paper reviews the characteristics of zebrafish motor behavior and its applications in the pharmacodynamic verification and mechanism research of TCM extracts, active ingredients, and TCM compounds, as well as in active ingredient screening and safety evaluation. The paper also analyzes its advantages and disadvantages, with the aim of improving the breadth and depth of zebrafish and its motor behavior applications in the field of TCM research.
Zebrafish/physiology* ; Medicine, Chinese Traditional ; Drugs, Chinese Herbal/therapeutic use* ; Disease Models, Animal ; Drug Evaluation, Preclinical/methods* ; Animals ; Sleep Wake Disorders/physiopathology* ; Epilepsy/physiopathology* ; Neurodegenerative Diseases/physiopathology* ; Fatigue/physiopathology* ; Behavior, Animal/physiology* ; Motor Activity/physiology*

To elucidate the mechanism by which steaming affects the quality of Curcuma kwangsiensis root tubers, methods such as LSCM, RVA, dual-wavelength spectrophotometry, LF-NMR, and LC-MS were employed to qualitatively and quantitatively detect changes in starch gelatinization characteristics, water distribution, and material composition of C. kwangsiensis root tubers under different steaming durations. Based on multivariate statistical analysis, the correlation between differences in gelatinization parameters, water distribution, and terpenoid material composition was investigated. The results indicate that steaming affects both starch gelatinization and water distribution in C. kwangsiensis. During the steaming process, transformations occur between amylose and amylopectin, as well as between semi-bound water and free water. After 60 min of steaming, starch gelatinization and water distribution reached an equilibrium state. The content of amylopectin, the amylose-to-amylopectin ratio, and parameters such as gelatinization temperature, viscosity, breakdown value, and setback value were significantly correlated(P≤0.05). Additionally, the amylose-to-amylopectin ratio was significantly correlated with total free water and total water content(P≤0.05). Steaming induced differences in the material composition of C. kwangsiensis root tubers. Clustering of primary metabolites in the OPLS-DA model was distinct, while secondary metabolites were classified into 9 clusters using the K-means clustering algorithm. Differential terpenoid metabolites such as(-)-α-curcumene were significantly correlated with zerumbone, retinal, and all-trans-retinoic acid(P<0.05). Curcumenol was significantly correlated with isoalantolactone and ursolic acid(P<0.05), while all-trans-retinoic acid was significantly correlated with both zerumbone and retinal(P<0.05). Alpha-tocotrienol exhibited a significant correlation with retinal and all-trans-retinoic acid(P<0.05). Amylose was extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and α-tocotrienol(P<0.05). Amylopectin was significantly correlated with zerumbone(P<0.05) and extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and 9-cis-retinoic acid(P<0.01). The results provide scientific evidence for elucidating the mechanism of quality formation of steamed C. kwangsiensis root tubers as a medicinal material.
Curcuma/chemistry* ; Starch/chemistry* ; Multivariate Analysis ; Water/chemistry* ; Terpenes/analysis* ; Plant Roots/chemistry* ; Plant Tubers/chemistry* ; Drugs, Chinese Herbal/chemistry*

OBJECTIVE: To determine risk factors for cutout failure in geriatric intertrochanteric fracture patients after cephalomedullary nail fixation. METHODS: A retrospective review of 518 elderly patients who underwent cephalomedullary nail fixation for intertrochanteric fractures between January 2008 and August 2018 was conducted, including 167 males and 351 females, age from 65 to 97 years old. All patients were followed up for at least one year after surgery and divided into a healed group and a cutout group based on whether the hip screw cutout occurred. Among all patients, 10 cases experienced hip screw cutout. The general information, surgical data, and radiological data of the two groups were compared, and risk factors influencing hip screw cutout were analyzed. Propensity score matching was then performed on the cutout group based on gender, age, body mass index(BMI), and American Society of Anesthesiologists(ASA), and 40 patients from the healed group were matched at a ratio of 1∶4. Key risk factors affecting hip screw cutout were further analyzed. Multivariable logistic regression analysis was conducted to evaluate associations between variables and cutout failure. RESULTS: There were no statistically significant differences between the healed group and the cutout group in terms of age, gender, BMI, ASA, and AO classification. However, statistically significant differences were observed between the two groups in terms of reduction quality(P=0.003) and tip-apex distance(TAD), P<0.001. Multivariate analysis identified poor reduction quality OR=23.138, 95%CI(2.163, 247.551), P=0.009 and TAD≥25 mm OR=30.538, 95%CI(2.935, 317.770), P=0.004 as independent risk factors for cutout failure. CONCLUSION The present study identified poor reduction quality and TAD≥25 mm as factors for cutout failure in geriatric intertrochanteric fractures treated with cephalomedullary nails. Further studies are needed to calculate the optimal TAD for cephalomedullary nails.
Humans ; Male ; Female ; Hip Fractures/surgery* ; Aged, 80 and over ; Aged ; Risk Factors ; Retrospective Studies ; Fracture Fixation, Intramedullary/adverse effects* ; Bone Nails ; Bone Screws

PURPOSE: We carried out the study aiming to explore and analyze the risk factors, the distribution of pathogenic bacteria, and their antibiotic-resistance characteristics influencing the occurrence of surgical site infection (SSI), to provide valuable assistance for reducing the incidence of SSI after traumatic fracture surgery. METHODS: A retrospective case-control study enrolling 3978 participants from January 2015 to December 2019 receiving surgical treatment for traumatic fractures was conducted at Tangdu Hospital of Air Force Medical University. Baseline data, demographic characteristics, lifestyles, variables related to surgical treatment, and pathogen culture were harvested and analyzed. Univariate analyses and multivariate logistic regression analyses were used to reveal the independent risk factors of SSI. A bacterial distribution histogram and drug-sensitive heat map were drawn to describe the pathogenic characteristics. RESULTS: Included 3978 patients 138 of them developed SSI with an incidence rate of 3.47% postoperatively. By logistic regression analysis, we found that variables such as gender (males) (odds ratio (OR) = 2.012, 95% confidence interval (CI): 1.235 - 3.278, p = 0.005), diabetes mellitus (OR = 5.848, 95% CI: 3.513 - 9.736, p < 0.001), hypoproteinemia (OR = 3.400, 95% CI: 1.280 - 9.031, p = 0.014), underlying disease (OR = 5.398, 95% CI: 2.343 - 12.438, p < 0.001), hormonotherapy (OR = 11.718, 95% CI: 6.269 - 21.903, p < 0.001), open fracture (OR = 29.377, 95% CI: 9.944 - 86.784, p < 0.001), and intraoperative transfusion (OR = 2.664, 95% CI: 1.572 - 4.515, p < 0.001) were independent risk factors for SSI, while, aged over 59 years (OR = 0.132, 95% CI: 0.059 - 0.296, p < 0.001), prophylactic antibiotics use (OR = 0.082, 95% CI: 0.042 - 0.164, p < 0.001) and vacuum sealing drainage use (OR = 0.036, 95% CI: 0.010 - 0.129, p < 0.001) were protective factors. Pathogens results showed that 301 strains of 38 species of bacteria were harvested, among which 178 (59.1%) strains were Gram-positive bacteria, and 123 (40.9%) strains were Gram-negative bacteria. Staphylococcus aureus (108, 60.7%) and Enterobacter cloacae (38, 30.9%) accounted for the largest proportion. The susceptibility of Gram-positive bacteria to Vancomycin and Linezolid was almost 100%. The susceptibility of Gram-negative bacteria to Imipenem, Amikacin, and Meropenem exceeded 73%. CONCLUSION Orthopedic surgeons need to develop appropriate surgical plans based on the risk factors and protective factors associated with postoperative SSI to reduce its occurrence. Meanwhile, it is recommended to strengthen blood glucose control in the early stage of admission and for surgeons to be cautious and scientific when choosing antibiotic therapy in clinical practice.
Humans ; Surgical Wound Infection/epidemiology* ; Male ; Female ; Risk Factors ; Retrospective Studies ; Middle Aged ; Adult ; Case-Control Studies ; Fractures, Bone/surgery* ; Aged ; Drug Resistance, Bacterial ; Logistic Models ; Anti-Bacterial Agents/therapeutic use* ; Incidence ; Bacteria/drug effects*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Apical microsurgery is accurate and minimally invasive, produces few complications, and has a success rate of more than 90%. However, due to the lack of awareness and understanding of apical microsurgery by dental general practitioners and even endodontists, many clinical problems remain to be overcome. The consensus has gathered well-known domestic experts to hold a series of special discussions and reached the consensus. This document specifies the indications, contraindications, preoperative preparations, operational procedures, complication prevention measures, and efficacy evaluation of apical microsurgery and is applicable to dentists who perform apical microsurgery after systematic training.
Microsurgery/standards* ; Humans ; Apicoectomy ; Contraindications, Procedure ; Tooth Apex/diagnostic imaging* ; Postoperative Complications/prevention & control* ; Consensus ; Treatment Outcome

Pulpotomy, which belongs to vital pulp therapy, has become a strategy for managing pulpitis in recent decades. This minimally invasive treatment reflects the recognition of preserving healthy dental pulp and optimizing long-term patient-centered outcomes. Pulpotomy is categorized into partial pulpotomy (PP), the removal of a partial segment of the coronal pulp tissue, and full pulpotomy (FP), the removal of whole coronal pulp, which is followed by applying the biomaterials onto the remaining pulp tissue and ultimately restoring the tooth. Procedural decisions for the amount of pulp tissue removal or retention depend on the diagnostic of pulp vitality, the overall treatment plan, the patient's general health status, and pulp inflammation reassessment during operation. This statement represents the consensus of an expert committee convened by the Society of Cariology and Endodontics, Chinese Stomatological Association. It addresses the current evidence to support the application of pulpotomy as a potential alternative to root canal treatment (RCT) on mature permanent teeth with pulpitis from a biological basis, the development of capping biomaterial, and the diagnostic considerations to evidence-based medicine. This expert statement intends to provide a clinical protocol of pulpotomy, which facilitates practitioners in choosing the optimal procedure and increasing their confidence in this rapidly evolving field.
Humans ; Calcium Compounds/therapeutic use* ; Consensus ; Dental Pulp ; Dentition, Permanent ; Oxides/therapeutic use* ; Pulpitis/therapy* ; Pulpotomy/standards*