1.Association of Human Epidermal Growth Factor Receptor 2 and Progesterone Receptor Expression in the Estrogen-receptor Negative Breast Cancer Patients
Ning WANG ; Bin WANG ; Chunyan XUE ; Yajie WANG
Journal of Medical Research 2006;0(05):-
0.05). Women with triple negative breast cancer experienced more lymph node metastases (71.9%︰58.5%,P=0.034),with the higher percentage of more than 10 lymph nodes metastases(26.0%)as compared with Her-2-overexpressing breast cancer (12.2%,P=0.034). A higher percentage of histological grade 3 was identified in triple-negative (67.7%)than in Her-2-overexpressing breast cancer(42.1%,P0.05). However,significantly poorer 5-year DFS was seen in patients with triple negative phenotype (61.85 months)than with Her-2-overexpressing phenotype (78.69 months,P=0.047). Conclusion Triple-negative breast cancers were more aggressive,and these women had poorer DFS comparing with Her-2-overexpressing ones.
2.Study of white matter in adolescent patients with depression by MR-diffusion tensor imaging
Ning MAO ; Bin WANG ; Cong XU ; Quanyuan LIU ; Guangbin WANG
The Journal of Practical Medicine 2014;(23):3759-3762
Objective To investigate the changes of the white matter in adolescent depression by using the method of tract-based spatial statistics (TBSS). Methods We employed TBSS to examine WM microstructure in 35 treatment-naive adolescents with clinical depression and in 40 matched controls. By using the TBSS, we compared the difference of fractional anisotropy (FA), axial diffusivity (AD), radial diffusivity (RD) and mean diffusivity (MD) between theadolescent patients with depression and the controls. Results Our analysis revealed the abnormal WM microstructures in the clinically depressed adolescents. The whole-brain analysis revealed that patients, with lower FA values in the body of the corpus callosum (CC) (P < 0.01), had elevated RD and MD (P < 0.01), and preserved AD (P > 0.05). The FA values in the body of the corpus callosum was negatively correlated with the severity of depression (P < 0.01). Conclusions Our findings suggest that WM abnormalities are involved in the path-physiology of depression. Importantly , our findings show that these WM abnormalities present early in the course of the disorder.
3.3D printing personalized implant manufactured via fused deposition modeling: an accuracy research.
Ning WANG ; Jie LI ; Xiaolong WANG ; Gang LIU ; Bin LIU
West China Journal of Stomatology 2015;33(5):509-512
OBJECTIVEThe aim of this study was to determine the accuracy of personalized implant fabricated via 3D printing and fused deposition modeling technique (FDM) and to compare the results with a real tooth.
METHODSSix prepared extracted orthodontic teeth (in vivo) were scanned via cone beam computed tomography (CBCT) to obtain 3D data and to build the data models by using Mimics 15.0 software. The extracted orthodontic teeth (in vitro) and the personalized implants designed via 3D printing and FDM were scanned via CBCT to obtain data and to build the data models at the same parameters. The 3D deviations were compared among the in vivo teeth data models, in vitro teeth data models, and printing personalized implant data models by using the Geomagic studio software.
RESULTSThe average deviations of high and low areas between date models of in vivo teeth and personalized implants were 0.19 mm and -0.16 mm, respectively, and the average deviations between in vitro and in vivo teeth were 0.14 mm and -0.07 mm, respectively. The independent t test showed that no statistically significant difference was observed between the two groups (P>0.05).
CONCLUSION1) The personalized dental implants were manufactured via 3D printing and FDM with a high degree of precision. 2) Errors between the data models of in vitro and in vivo teeth were observed at the same CBCT parameters.
Cone-Beam Computed Tomography ; Dental Implants ; Humans ; Imaging, Three-Dimensional ; Printing, Three-Dimensional ; Software ; Tooth
4.Effect of estrogen replacement therapy on respiratory of ovariectomized rats
Feng-bin WANG ; Lu-juan WANG ; Ning LI ; Xiuzhen CHENG
Chinese Journal of Rehabilitation Theory and Practice 2004;10(8):477-478
ObjectiveTo observe effect of estradiol on respiratory of ovariectomized rats.Methods30 adult female rats were randomly divided into ovariectomy group (group A), estradiol group (group B) and sham ovariectomy group (group C). Rats of group B were injected with 17-β estradiol (20μg/kg/d), that of group A and group C were injected only with normal saline (0.1ml/d). After 6 weeks, effect of estradiol on respiratory of ovariectomized rats was assessed with testing level of rats' serum estradiol and discharge frequency and integrated amplitude of phrenic nerve. ResultsThe level of serum estradiol of group A was significantly decreased compared with group B and group C (P<0.01). Discharge frequency and integrated amplitude of phrenic nerve of group A were decreased compared with group B and group C (P<0.05).ConclusionEstradiol can excite respiratory responses in ovariectomized rats.
5.Studies on concentrations and interactions of drugs in patients with administration of high-dose of cytosine arabinoside and methotrexate.
Yan-ning QU ; Bin JIANG ; Yu-hang WANG
Chinese Journal of Hematology 2012;33(12):1049-1051
Adolescent
;
Adult
;
Cytarabine
;
administration & dosage
;
blood
;
pharmacology
;
Drug Interactions
;
Female
;
Humans
;
Instillation, Drug
;
Leukemia
;
blood
;
drug therapy
;
Male
;
Methotrexate
;
administration & dosage
;
blood
;
pharmacology
;
Middle Aged
;
Young Adult
6.A health behaviors research about the community-dwelling older people with different risk of osteoporotic fractures
Yuhuan WANG ; Bin HE ; Wei ZHANG ; Ning LU
Chinese Journal of Behavioral Medicine and Brain Science 2012;21(3):247-249
Objective To find out a health behaviors about the community-dwelling older people with different risk of osteoporotic fractures,and to provide the interventions basis for high risk population.Methods By fracture risk assessment tool(FRAX).Stratified sampling method was used.Data were collected by face-to-face interviews with questionnaires in 450 people aged 60 years and over who come from the three communities.Results By the statistical test,the scores of behavior between high and low risk older people had statistical significance(P<0.01 ).The scores of high risk of osteoporotic fractures behavior in older people were 30.59 ± 4.67,which rate was 56.6%.There were 86 people who scored 33 and over,pass rate was only 37.2% ; The behavior scores of low risk of osteoporotic fractures older people were 32.01 ± 4.49,which rate was 59.3%.There were 102 people who scored 33 and over,pass rate was only 46.6%.The one way ANOVA found that theeducation level were main factors for low risk of osteoporotic fractures elderly people in prevention behavior.By the multiple liner stepwise regression,gender and monthly income were main factors for high risk of osteoporotic fractures elderly people in prevention behavior.Conclusion Focus on those older people who have the low-income,male group in high risk of osteoporotic fractures to improving health behavior intervention,which include those in low risk of osteoporotic fractures but have low level of education.
7.Study of recombinant adeno-associated virus 2-mediated cotransfer of hTGF-β1 and hTGF-β3 encoding genes to the rabbit degenerative nucleus pulposus cells
Haifei LIU ; Bin NING ; Dechun WANG ; Yougu HU
Chinese Journal of Orthopaedics 2011;31(4):357-364
Objective 1) To verify the the potential of the adenoassociated viral vector as a strategy for intradiscal gene transfer in degenerative rabbit intervertebral discs. 2) To investigate the gene transduction efficacy and to quantify the biologic effects on the matrix synthesis after single gene transfer and combined gene transfer. Methods Rabbit models of disc degeneration were established by injecting the N-terminal 30×103 fibronectin fragment (Fn-f), 4 weeks later, saline with or without virus was injected directly into 144 lumbar discs of 36 skeletally mature New Zealand white rabbits. Group A (n =8) received the rAAV2-hTGFβ1; Group B (n=6) received rAAV2-hTGFβ3;Group C (n=6) recived rAAV2-hTGFβ1 and rAAV2-hTGFβ3; Group D (n=8) recived rAAV2-EGFP as the experimental control. Group E (n=8) recived PBS as the blank control. Two rabbits of the group A and group E were sacrefied 1 week after injection, immunohistochemical staining for hTGF-β1 was performed on the slices of nucleus pulposus (NP) tissues. On 4,8 and 12 weeks after gene transferring, NP tissues were cultured or decomposed to quantify the biochemical changes of the matrix using 35S-sulfate incorporation assay and western blot detection. The expression of EGFP was observed 12 weeks after injection. Results Discs in group A exhibited extensive and intense positive immunostaining for hTGF-β1 than the control discs in group E 1 week after gene transferring. The nucleus pulposus tissues in group A, B and C exhibited a 1.28-2.06 fold increase in proteoglycan synthesis and a 1.25-1.73 fold increase in collagen type Ⅱ production over those in group E (P<0.05 or P<0.01).Combination of two gene transfer in group C makes a significantly increased level of proteoglycan (1.195-1.290 fold)and collagen type Ⅱ (1.152-1.219 fold) than single gene transfer in group A and B(P<0.05 or P<0.01).No statistic differences shows between A group and B group. The difference of the matrix synthesis between group D and group E was also not statistically significant (P>0.05). Extensive and intensive green fluorescence was observed on the slice of nucleus pulposus tissues received rAAV2-EGFP 12 weeks after gene delivery. The expression of EGFP kept for more than 12 weeks. Conclusion Findings showed that the disc tissue injected with rAAV2 mediated genes highly expressed the therapeutic proteins from 1 week to more than 12 weeks after delivery. It is suggested that adenoassociated virus be an valid vector for the transfer of the exogenous genes in the degenerative disc. The therapeutic factors hTGF-β1 and hTGF-β3 could efficiently increase the synthesis of proteoglycan and collagen type Ⅱ in the degenerative NP cells and combined transfer of two genes was more effective than single gene transfer. The two factors have an positive synergistic effects.
8.Effect analysis of surgical treatment for ankle osteoarthritis under arthroscopy
Yuqiang LIU ; Xupeng WANG ; Ning LIU ; Zhenlei LIANG ; Bin HU
Clinical Medicine of China 2017;33(2):159-161
Objective To discuss the clinical effect of surgical treatment for ankle osteoarthritis under arthroscopy.Methods Forty-eight cases with ankle osteoarthritis patients admitted at the Orthopaedic Hospital of Zhengzhou from January 2012 to June 2014 were selected and all of them were given the treatment of focal cleaning under arthroscopy.The clinical effect of surgical treatment were judged by modified McGuire ankle rating system,the United States after ankle surgery AOFAS ankle-full score and Mazur ankle rating system respectively.Results At the time of the last follow-up,modified McGuire ankle rating system((85.64±16.52)points vs.(52.46±10.25)points,t=-8.465),the United States after ankle surgery AOFAS ankle-full score [(85.24±11.46)points vs.(53.68±9.48)points,t=-7.548)and Mazur ankle rating system((86.45±12.57)points vs.(58.49±8.64)points,t=-6.596)all increased than that of pre-operation,the differences were statistically significant(P<0.05).The modified McGuire ankle rating system of patients with low-grade lesion at pre-operation((62.45±7.63)points vs.(49.58±6.35)points,t=3.685)and the time of the last follow-up((93.68±11.54)points vs.(68.54±9.68)points,t=8.695)were all higher than that of patients with high-grade lesion,the differences were statistically significant(P<0.05).The clinical effect of surgical treatment judged by modified McGuire ankle rating system,the United States after ankle surgery AOFAS ankle-full score and Mazur ankle rating system were respectively 91.67%(44/48),89.58%(43/48)and 89.58%(43/48),the differences were no statistically significant(x2=0.824,P>0.05).Conclusion The clinical effect of surgical treatment for ankle osteoarthritis under arthroscopy is remarkable and it causes light damage to the body.It is especially suitable for patients with low-grade lesions and is worth popularization and application.
9.Rat ?-defensin rBD-1 gene expresses constitutively in skin and kidney
Ning HUANG ; Qi WU ; Bin TANG ; Xinnian CHENG ; Boyao WANG
Chinese Journal of Pathophysiology 1986;0(01):-
AIM: To determine tissue distribution of rat ?-defensin rBD-1 gene expression.METHODS: Total RNA was isolated from 10 kinds of rat tissues. RT-PCR were performed with primers (R 1 5′→3′ ACTCTGGACCCTGACTTCACCG; R 2 5′→3′ CCCTTGCTTGTCCTTTATGTCC). The RT-PCR products around 272 bp in size were cloned into pGEM-T easy vector and the recombinant clones were analyzed by digestion with restriction endonucleases and DNA sequencing.RESULTS: Rat ?-defensin rBD-1 transcripts were found in the kidney and skin, whereas its mRNA was not detected in trachea, uterus, bladder, small intestine, spleen, skeletal muscle, bone marrow and parotid. Sequence analysis confirmed that the RT-PCR product is rBD-1 cDNA. CONCLUSION: These data suggested that ?-defensin rBD-1 may participate not only in the kidney but also in the skin natural defense against infections.
10.Drug-resistance of Pseudomonas aeruginosa:An Analysis of 286 Strains
Lifen NING ; Yuzhen WANG ; Bin XIE ; Jiafang ZHANG ; Xianhou YUAN
Chinese Journal of Nosocomiology 1994;0(04):-
OBJECTIVE To analyze the resistance of Pseudomonas aeruginosa (PAE) isolated from clinical specimen and provide the guidance for the clinical treatment. METHODS The P. aeruginosas infection status from Jun 2005 to Dec 2007 was reviewed retrospectively,and the results of susceptibility test in 286 strains of PAE were analyzed. RESULTS The drug-resistance rates to gentamicin,cefotaxime,and ceftriaxone in PAE were all above 60.0%,and that to cefoperazone/sulbactam,piperacillin/tazobactam sodium,amikacin and levofloxacin showing all higher sensitivity. The resistance rates to meropenem and imipenem were 17.1% and 18.5%,respectively. CONCLUSIONS P. aeruginosa is one of the main pathogenic bacteria in nosocomial infection. It's very important to strengthen the monitoring of drug-resistance of PAE and rationally antibiotics usage.