OBJECTIVE:To observe therapeutic efficacy and liver toxicity of chemotherapy combined with bevacizumab in the treatment of colorectal cancer liver metastases (CLMs). METHODS:126 CLMs patients were selected and randomly divided into chemotherapy group(54 cases)and combination group(72 cases). Chemotherapy group received FOLFOXIRI regimen:irinotecan 165 mg/m2+oxaliplatin 85 mg/m2+calcium folinate 200 mg/m2+fluorouracil 2 g. Combination group was additionally given bevaci-zumab 5 mg/kg one day before chemotherapy on the basis of FOLFOXIRI regimen. A treatment course of 2 groups lasted for 2 weeks,and both received 12 courses of treatment. The pathological response,survival rate and toxic reactions caused by chemother-apy were compared between 2 groups. RESULTS:Pathological complete response proportion,tumor remission rating(TRG),the proportion of patients with tumor necrosis rate ≥50% in combination group were significantly higher than chemotherapy group, with statistical significance (P<0.01). The proportion of TRG4-5,TRG 1-3 progression-free survival in combination group were significantly higher than chemotherapy group,with statistical significance (P<0.05). The incidence of liver parenchymal necrosis in combination group was significantlg higher than chemotherapy group,there was statistical significance (P>0.05). CONCLU-SIONS:Chemotherapy combined with bevacizumab can improve pathological response and the incidence of CLMs necrosis and doesn't increase liver toxicity.

OBJECTIVE:To evaluate the relative bioavailability of two products(CLMC 1 ,CLMC 2 )of Clarithromycin in man.METHODS:A single oral500mg dose of CLMC 1 or CLMC 2 was given to20healthy male volunteers in an open randomized crossover study.The plasma concentrations of CLMC 1 and CLMC 2 were measured by microbial assay.The pharmacokinetic parameters were calculated with3p97pharmacokinetic program and the bioequivalence was evaluated.RESULTS:The con?centration-time curves of CLMC 1 and CLMC 2 fitted to a two-compartent open model.C max were(2.23?0.83)?g/ml and(2.14?0.70)?g/ml;T max were(1.95?0.39)h,(1.78?0.41)h;AUC (0～T) were(9.50?2.52)(?g?h)/ml,(9.35?2.54)(?g?h)/ml respectively.The relative bioavailability of CLMC 1 was(101.60?9.35)%.CONCLUSION:The results of two and one-side t tests suggest that the CLMC 1 is bioequivalent with the CLMC 2 .

Objective To assess the clinical feasibility and safety of coronary artery angiography(CAG) and intervention through transradial approach. Methods 134 patients received coronary artery angiography and interventions through transradial approach were selected. The complications such as hematoma, thrombus were observed. Results Transradial puncture succeed in 126 cases, the successful rate of transradial coronary intervention was 94.0%.The complication occurred in 12 patients (8.9%). Conclusion This investigation demonstrated the safety and feasibility of transradial approach for coronary angiography with less procedure complications and pain for patient.

Objective To study pathological diagnostic value of forceps and brush biopsy cytological examination by percutaneous transhepatic cholangiodrainage(PTCD) for malignant obstructive jaundice.Methods From April 2005 to April 2006,24 cases of obstructive jaundice underwent PTCD and stent insertion in biliary tract.Tissue pathological examination by forceps and brush was done during PTCD.Results 24 cases received forceps biopsy,of whom,14 cases received brush cytological examination at the same time.All of the 24 cases of forceps biopsy obtained pathological tissue and the pathological results as follows: adencarcinoma in 15 cases,4 cases had allotype cells,regarded as positive results;inflammation tissue in 1 case,which was restenosis after stent insertion;fibrous tissue in 1 case;tissue obtained was cholangioepithelia in 3 cases,in which 1 case was diagnosed as lymph node metastasis of peripheral head of pancreas after gastric cancer operation,2 cases were diagnosed as cholangiocarcinoma,the positive rate of forceps biopsy being 79.2%(19/24).4 cases of cytological examinations by brush showed tumor cells in 2 cases,allotype cells in 2 cases,regarded as positive results,the positive rate being 28.6%(4/14),and others were negative results.Conclusions Intracholangio-biopsy by PTCD offers the advantages of simplicity,safety,higher accuracy and less complications.Pathological diagnosis can be obtained at the same time during reducing-jaundice therapy by PTCD.

Purpose: To investigate the security and clinical value of percutaneous intravascular home-made port-catheter-system(PCS) implatation. Materials and Methods: This technique was used to treat thoracic, abdominal and pecvic malignant tuwcors in 63 patients. Intra-arterial injection of anticancerous agents and lipiodol were regularly carried out Via PCS. Results: All PCS implatation were successful. The PCS catheter tips were all retained within target vessels. The related complications in- cluded local hemorrhage (5 cases, 7.9%), wound delaged healing or wound dehiscence (4 cases, 6. 3%), indwelling catheter blockage (4 cases, 6. 3%), migrating of catheter tip (1case, 1.5%), local infection (2cases, 3.1%). Most of these cases were recovered after appropriate management without any fatal and pevae sequelae. Conclusion: Percutaneous Intravascular home-made port-eatheter system implantation is safe and reliable. Home-made PCS is cheaper and more suitable for chinese than im- ported products.

To investigate the value of the guidance of three dimensional (3-D) reconstruction of multi-slice spiral CT (MSCT) for the placement of pedicle screws, the 3-D anatomical data of the thoracic pedicles were measured by MSCT in two embalmed human cadaveric thoracic pedicles spines (T1-T10) to guide the insertion of pedicle screws. After pulling the screws out, the pathways were filled with contrast media. The PW, PH, TSA and SSA of developed pathways were measured on the CT images and they were also measured on the real objects by caliper and goniometer. Analysis of variance demonstrated that the difference between the CT scans and real objects had no statistical significance (P > 0.05). Moreover, the difference between pedicle axis and developed pathway also had no statistical significance (P > 0.05). The data obtained from 3-D reconstruction of MSCT demonstrated that individualized standards, are not only accurate but also helpful for the successful placement of pedicle screws.

OBJECTIVETo construct microRNA-223 overexpression and suppression lentivirus vectors and determine their effects after infecting oral squamous cell carcinoma (OSCC) cell line.

METHODSLentivirus vectors GV229 and GV232 were cut by the restriction sites of Age I and EcoR I and connected to the target gene, which contained mature microRNA-223 and microRNA-223 oligonucleotide. Real-time polymerase chain reaction (PCR) method was used to detect the microRNA-223 expression level after infecting the recombinant lentivirus vector into the OSCC cell line.

RESULTSThe successful construction of microRNA-223 recombinant lentivirus vectors was confirmed by the PCR method and DNA sequencing. HN-30 cell infected with microRNA-223 overexpression vector showed a significant increased in microRNA-223 expression, whereas HN-30 cell infected with microRNA-223 inhibitor vector suppressed microRNA-223 expression.

CONCLUSIONThe microRNA-223 overexpression and suppression lentivirus vectors are successfully constructed. These vectors could alter the expression level of microRNA-223 in OSCC cell line significantly, and provide a stable cell line for functional studies in the future.

Objective To observe the operation process implementation and the therapeutic effect of interventional therapy for the superior mesenteric artery thrombosis.Methods 21 cases with superior mesenteric arterial thrombosis who had the diagnosis and clinical treatment in our hospital from January 2005 to December 2013 were retrospectively analyzed.Results Among 21 cases,19 cases had obvious risk factors,and their early symptoms and signs were not consistent.The artery angiography showed that 17 cases had superior mesenteric artery thrombosis,2 cases had ileum arterial thrombosis,2 cases had inferior mesenteric arterial thrombosis.All surgeries were performed successfully.The length of hospital stay was 10 14 days with an average of 11 days.After interventional treatment,the symptom of abdominal pain had obvious remission.The follow-up period was 12 to 36 months and no recurrence was found.Conclusions The diagnosis of mesenteric arterial thrombosis is difficult.Mesenteric arterial thrombosis needs the early diagnosis and timely interventional treatment.

AIM: To investigate the developmental regulation of ?-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P 1: TTCAGTCATGAGGATCCATT AC; P 2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS: Rat ?-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION: The rat ?-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that ?-defensin-2 may play a role in the lung innate defense against infection.

Objective To explore the effects of hyperglycemia and oxidized low density lipoprotein (ox-LDL) on the differentiation of macrophage derived THP-1 monocytes. Methods THP-1 human monocytic leukemia cell line was cultured in vitro, and the differentiation of THP-1 cells into macrophages was induced by phorbol esters. The macrophages were then incubated with the absence of D-glucose and ox-LDL (control group), 30 mmol/L D-glucose (hyperglycemia group), 100 μg/mL ox-LDL (ox-LDL group) or 30 mmol/L D-glucose and 100 μg/mL ox-LDL(G-ox-LDL group) for 24 h. High performance liquid chromatography was used for qualitative and quantitative analysis of intracellular cholesterol and cholesteryl esters. Both light microscope with red oil O staining technique and transmission electron microscope were employed to observe the morphology of treated and control THP-1 cells. Results A large number of intracellular red oil O stained granules and lipid vacuoles were observed in ox-LDL group and G-ox-LDL group, the contents of total cholesterol and cholesteryl esters were significantly higher than those of control group (P<0.05), and the contents of cholesteryl esters were higher than 50% of total cholesterol in both groups. However, only a few intracellular red oil O stained granules and lipid vacuoles were observed in control group and hyperglycemia group, there was no significant difference in the contents of total cholesterol and choleateryl esters between control group and hyperglycemia group (P>0.05), and the contents of cholesteryl esters were less than 50% of total cholesterol in both groups. Conclusion Foam cells form when THP-1 cells are incubated with ox-LDL, while hyperglycemia alone can not convert THP-1 cells to foam cells, indicating that ox-LDL is necessary for the macrophages derived THP-1 monocytes to turn into foam cells.